ID: 1034979587

View in Genome Browser
Species Human (GRCh38)
Location 7:155467414-155467436
Sequence CACAGATTTGTGAGCGATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034979581_1034979587 20 Left 1034979581 7:155467371-155467393 CCGGACCCTGGGTCGGGCAGGCC No data
Right 1034979587 7:155467414-155467436 CACAGATTTGTGAGCGATGCTGG No data
1034979577_1034979587 23 Left 1034979577 7:155467368-155467390 CCCCCGGACCCTGGGTCGGGCAG No data
Right 1034979587 7:155467414-155467436 CACAGATTTGTGAGCGATGCTGG No data
1034979586_1034979587 -1 Left 1034979586 7:155467392-155467414 CCTGGCGCTGGCAGCTCTGTTGC No data
Right 1034979587 7:155467414-155467436 CACAGATTTGTGAGCGATGCTGG No data
1034979578_1034979587 22 Left 1034979578 7:155467369-155467391 CCCCGGACCCTGGGTCGGGCAGG No data
Right 1034979587 7:155467414-155467436 CACAGATTTGTGAGCGATGCTGG No data
1034979584_1034979587 14 Left 1034979584 7:155467377-155467399 CCTGGGTCGGGCAGGCCTGGCGC No data
Right 1034979587 7:155467414-155467436 CACAGATTTGTGAGCGATGCTGG No data
1034979583_1034979587 15 Left 1034979583 7:155467376-155467398 CCCTGGGTCGGGCAGGCCTGGCG No data
Right 1034979587 7:155467414-155467436 CACAGATTTGTGAGCGATGCTGG No data
1034979580_1034979587 21 Left 1034979580 7:155467370-155467392 CCCGGACCCTGGGTCGGGCAGGC No data
Right 1034979587 7:155467414-155467436 CACAGATTTGTGAGCGATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034979587 Original CRISPR CACAGATTTGTGAGCGATGC TGG Intergenic
No off target data available for this crispr