ID: 1034982416

View in Genome Browser
Species Human (GRCh38)
Location 7:155487606-155487628
Sequence GACGCGGGGTCTCCCGCTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 89}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034982416_1034982421 2 Left 1034982416 7:155487606-155487628 CCCGCAGCGGGAGACCCCGCGTC 0: 1
1: 0
2: 1
3: 8
4: 89
Right 1034982421 7:155487631-155487653 TCCCTCTCTCCCTCAGCACCTGG No data
1034982416_1034982423 3 Left 1034982416 7:155487606-155487628 CCCGCAGCGGGAGACCCCGCGTC 0: 1
1: 0
2: 1
3: 8
4: 89
Right 1034982423 7:155487632-155487654 CCCTCTCTCCCTCAGCACCTGGG 0: 1
1: 0
2: 8
3: 80
4: 778

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034982416 Original CRISPR GACGCGGGGTCTCCCGCTGC GGG (reversed) Intronic
901676517 1:10888858-10888880 GACGCGGGGGCACCAGCTGCCGG + Intergenic
917966687 1:180183265-180183287 GACCCGGCGTCTCTCTCTGCAGG + Intronic
1063203109 10:3804502-3804524 GTAACGGGGTCTCCCACTGCTGG - Intergenic
1077124312 11:925705-925727 GGCGCGGGGGCGCCCCCTGCAGG - Intronic
1078063404 11:8062308-8062330 GTGGCAGGGTCTCCTGCTGCAGG - Intronic
1078594382 11:12674309-12674331 GAGGCGGGGCCTGCCGCCGCCGG - Intergenic
1078659928 11:13278162-13278184 CTCGCGGGGGCTGCCGCTGCGGG + Intronic
1079239054 11:18709587-18709609 GAGGGTGGGTCTCCCTCTGCAGG + Exonic
1083189807 11:61041828-61041850 GACTTGGGGTCACCCTCTGCTGG - Intergenic
1083881964 11:65553338-65553360 GACCTGGGGACTCCCACTGCAGG + Intronic
1084541121 11:69787801-69787823 GAAGTGGGGGCTCCAGCTGCGGG + Intergenic
1088512299 11:110590098-110590120 GAGGCGGGGTCTCACTCTGTCGG - Intronic
1089398821 11:118152854-118152876 GAGGCGCGCTCGCCCGCTGCTGG + Intronic
1089567899 11:119381694-119381716 GACGCGGGGTGTGGCTCTGCCGG - Exonic
1091273178 11:134332097-134332119 CACGCTGGGACTCCTGCTGCTGG + Exonic
1092163629 12:6329607-6329629 GTCGCGGGGTCATCAGCTGCGGG + Exonic
1096002409 12:48140749-48140771 AACGTGGGGGCTCCGGCTGCAGG + Exonic
1096004358 12:48157121-48157143 GCCGCGGGCCCTCCCGCAGCAGG - Intronic
1103617264 12:122162273-122162295 GAAGCGGGGTCTCCATGTGCTGG - Intergenic
1105349414 13:19602169-19602191 GACCCGGCGCCTCCAGCTGCGGG + Intergenic
1111288492 13:86128480-86128502 GACACGGGGTTTCACCCTGCTGG + Intergenic
1113861599 13:113490786-113490808 GCCGCGGGGACTCCCACTCCCGG + Exonic
1121473294 14:94173753-94173775 GACGCGGGGTGCCCGGCTGACGG - Intronic
1122719935 14:103716180-103716202 GGCGCGCGGTGTCCCGGTGCGGG + Intronic
1124496845 15:30192342-30192364 GAGGCGGCCTCTCCCGCAGCGGG - Intergenic
1124746731 15:32346305-32346327 GAGGCGGCCTCTCCCGCAGCGGG + Intergenic
1131421390 15:92308511-92308533 GAGGCAGGGTCTCACTCTGCTGG + Intergenic
1132393354 15:101454756-101454778 GAGGCGGGGTTTCACGCTGTTGG - Intronic
1132659230 16:1054156-1054178 GAGGCCGGGTCCCCGGCTGCCGG - Intergenic
1134055333 16:11166454-11166476 GCCGCTGGGGCTCCCGCTGGCGG - Exonic
1134457542 16:14405846-14405868 GAGGCGGGGCCTCGGGCTGCAGG - Intergenic
1135479755 16:22813377-22813399 GACGCGGAGTCTGCCGCTCCGGG + Intergenic
1136224054 16:28846741-28846763 GACTCGGGGTCTCTCTCTGCCGG - Exonic
1142221316 16:88856568-88856590 GACGGGGGGTATCCCCGTGCGGG - Intronic
1143107593 17:4537310-4537332 GACCCTGGGTCTCGTGCTGCTGG - Intronic
1143116578 17:4584791-4584813 GCCGCTGGTTGTCCCGCTGCAGG - Exonic
1145996680 17:29108841-29108863 GAAGGGGGGCCTGCCGCTGCTGG + Intronic
1146142427 17:30379311-30379333 GACGCGGGGCCTGACGCTGCCGG + Exonic
1146716367 17:35089544-35089566 GTCGTGGGGTCGGCCGCTGCTGG + Intronic
1152307776 17:79531228-79531250 GGGGTGGGGTCTCCTGCTGCCGG + Intergenic
1152640766 17:81448304-81448326 GAGGCTGGGGCTCCTGCTGCAGG + Intronic
1152786494 17:82250634-82250656 GGGGCGGGGTCTCCAGATGCTGG - Intronic
1154501583 18:15000277-15000299 CACGCGGGAGCTCCCGCTGCGGG - Intergenic
1155133083 18:22958573-22958595 GAGGCAGGGTCTCGCTCTGCTGG + Intronic
1160521006 18:79507925-79507947 GACGCGGCGACTGCGGCTGCGGG - Intronic
1161057959 19:2200090-2200112 CACGCTGGGTCTCCCTCTGCGGG + Intronic
1165311819 19:35033139-35033161 GAGTTGGGGTCTCCAGCTGCTGG + Intronic
1166706214 19:44909310-44909332 GGGACAGGGTCTCCCGCTGCAGG - Exonic
926113570 2:10197283-10197305 GAGGCTGGGTCTGCAGCTGCCGG + Intronic
941580746 2:167293306-167293328 GGCGCGTGGTCTCCGGCCGCTGG - Intergenic
1171939627 20:31313248-31313270 GAGACGGAGTCTCCCTCTGCTGG - Intergenic
1176110599 20:63408916-63408938 CACGGAGGGTCTCCCACTGCAGG + Intronic
1180177636 21:46098214-46098236 GACTCGGGGTCACCCCCCGCGGG - Intronic
1181349251 22:22243753-22243775 GAGGCAGGGTCTCCCTCTGTTGG + Intergenic
1182555600 22:31126899-31126921 GCCACGTGGCCTCCCGCTGCAGG + Exonic
1184594845 22:45507546-45507568 GAGACGGGGTCTCACTCTGCCGG + Intronic
1185130822 22:49037619-49037641 GCTGCGGCCTCTCCCGCTGCAGG - Intergenic
960537344 3:118828353-118828375 GATGTGGGGCCTCCCGCTGCTGG - Intergenic
963870688 3:150410380-150410402 GCCGCGGGGGCGCCCACTGCAGG - Exonic
967866469 3:194194163-194194185 AACGAGGAGTCTCCTGCTGCTGG + Intergenic
968914888 4:3493112-3493134 GGCTCGGGGGCCCCCGCTGCTGG - Exonic
968950023 4:3685760-3685782 GACCTGGGGTCTCCCTGTGCAGG - Intergenic
974088144 4:57282780-57282802 GATGCTGGGACTCCAGCTGCTGG + Intergenic
981782095 4:148442281-148442303 GCCTCGGGCTCTCCCGCTGCAGG - Exonic
995650340 5:114362052-114362074 GGAGCGGGGACTCCTGCTGCTGG - Exonic
998854229 5:146379052-146379074 GACGCGGGGTCCCCTGCTGCCGG - Intergenic
1001404002 5:171462798-171462820 GACACGGGGCCTGCAGCTGCAGG - Intergenic
1005748701 6:28863922-28863944 GGCCTGGGATCTCCCGCTGCAGG + Intergenic
1019612085 7:1941705-1941727 GACCCAGGGCCTCCTGCTGCAGG - Intronic
1020100289 7:5390543-5390565 GAGGAGGGGGCTCCCACTGCTGG + Exonic
1023867101 7:44243512-44243534 GAAGCAGGTTCTCCGGCTGCAGG + Exonic
1029539012 7:101172219-101172241 GGCGCGGGGCCTGGCGCTGCAGG + Exonic
1034982416 7:155487606-155487628 GACGCGGGGTCTCCCGCTGCGGG - Intronic
1037731204 8:21525394-21525416 GGGGGGGGGTCTCCTGCTGCTGG - Intergenic
1038554038 8:28494276-28494298 GACGCGCGGCCGCCCGCGGCAGG + Exonic
1042813496 8:72852046-72852068 GAAACAGGGTCTCCCTCTGCTGG - Intronic
1044832176 8:96261519-96261541 GTCCCGGGGTCACCCGCTACGGG - Exonic
1049515120 8:143050365-143050387 GACGCGGGGTTTCACCATGCTGG + Intronic
1057436480 9:95045243-95045265 GACACGGGTCCGCCCGCTGCAGG - Intronic
1059061571 9:111038809-111038831 GGCCACGGGTCTCCCGCTGCGGG - Intergenic
1060797465 9:126522392-126522414 GATGCGGGGTCTCCGGTTCCTGG - Intergenic
1062162338 9:135087412-135087434 GGCGCGGGGACTCCAGCTGGGGG - Intronic
1062498911 9:136844069-136844091 CACGCGGGAGCTCCCGCCGCGGG + Intronic
1062614234 9:137388794-137388816 GCCGCGGGGTCTGATGCTGCTGG - Intronic
1203778540 EBV:87858-87880 GCCGCGGGGCCTCCTGCCGCGGG + Intergenic
1203778546 EBV:87873-87895 GCCGCGGGGCCTCCTGCCGCGGG + Intergenic
1203778552 EBV:87888-87910 GCCGCGGGGCCTCCTGCCGCGGG + Intergenic
1203778558 EBV:87903-87925 GCCGCGGGGCCTCCTGCCGCGGG + Intergenic
1203778564 EBV:87918-87940 GCCGCGGGGCCTCCTGCCGCGGG + Intergenic
1203436088 Un_GL000195v1:138276-138298 GACGTGGGGGCCCTCGCTGCTGG - Intergenic
1187915439 X:24149463-24149485 GCGGCGGGGTCTCCGGCGGCCGG - Intronic
1189325781 X:40109757-40109779 GACTCGGCGAATCCCGCTGCGGG + Intronic
1190055415 X:47178599-47178621 GAAGCTGGGTCTCCAGATGCTGG + Intronic
1191933910 X:66405349-66405371 GTCAAGGGGTCTCCTGCTGCTGG + Intergenic
1195773726 X:108379866-108379888 GACTTGGGGTCTCCAACTGCTGG - Intronic
1200251619 X:154557181-154557203 AACGCGTGGCCTCCCGCTTCTGG + Intronic
1200253826 X:154568865-154568887 AACGCGTGGCCTCCCGCTTCTGG + Intergenic
1200263943 X:154635543-154635565 AACGCGTGGCCTCCCGCTTCTGG - Intergenic
1200266148 X:154647235-154647257 AACGCGTGGCCTCCCGCTTCTGG - Intergenic