ID: 1034983607

View in Genome Browser
Species Human (GRCh38)
Location 7:155494224-155494246
Sequence CTCCTCACTCGGATTTGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 85}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034983607_1034983612 -10 Left 1034983607 7:155494224-155494246 CCCCACCAAATCCGAGTGAGGAG 0: 1
1: 0
2: 0
3: 4
4: 85
Right 1034983612 7:155494237-155494259 GAGTGAGGAGCCCTGCAGCCTGG No data
1034983607_1034983620 25 Left 1034983607 7:155494224-155494246 CCCCACCAAATCCGAGTGAGGAG 0: 1
1: 0
2: 0
3: 4
4: 85
Right 1034983620 7:155494272-155494294 GCCGAGGGCCGCAGGCACCGTGG 0: 1
1: 0
2: 1
3: 11
4: 163
1034983607_1034983619 17 Left 1034983607 7:155494224-155494246 CCCCACCAAATCCGAGTGAGGAG 0: 1
1: 0
2: 0
3: 4
4: 85
Right 1034983619 7:155494264-155494286 CCGTCAGAGCCGAGGGCCGCAGG No data
1034983607_1034983617 10 Left 1034983607 7:155494224-155494246 CCCCACCAAATCCGAGTGAGGAG 0: 1
1: 0
2: 0
3: 4
4: 85
Right 1034983617 7:155494257-155494279 TGGATCTCCGTCAGAGCCGAGGG No data
1034983607_1034983616 9 Left 1034983607 7:155494224-155494246 CCCCACCAAATCCGAGTGAGGAG 0: 1
1: 0
2: 0
3: 4
4: 85
Right 1034983616 7:155494256-155494278 CTGGATCTCCGTCAGAGCCGAGG 0: 1
1: 0
2: 0
3: 5
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034983607 Original CRISPR CTCCTCACTCGGATTTGGTG GGG (reversed) Intronic
900873914 1:5327604-5327626 CTCCACCCTAGGATCTGGTGTGG + Intergenic
905718638 1:40176352-40176374 CTCCTCACTAACACTTGGTGTGG + Intronic
906121107 1:43391460-43391482 CAGTTCACTGGGATTTGGTGTGG + Intronic
906357841 1:45122830-45122852 CTCCCCACTCAGCCTTGGTGGGG - Intronic
909764461 1:79337975-79337997 ATTCTCAGTAGGATTTGGTGGGG + Intergenic
911324580 1:96455111-96455133 ATCCTCATTAGCATTTGGTGTGG + Intergenic
914988768 1:152480697-152480719 CCCCTCACTCGGCTGTTGTGGGG - Intergenic
915093500 1:153443295-153443317 CTCCTACCTCAGCTTTGGTGTGG + Intergenic
916775251 1:167955417-167955439 GTCCTCACCAGCATTTGGTGTGG + Intronic
921049862 1:211503637-211503659 CTCCTCACTGGGCTCTGGGGCGG - Intergenic
1062959205 10:1559955-1559977 TTCCTCACTCAGATCTGATGCGG - Intronic
1063128904 10:3160742-3160764 CACCACACTTGGTTTTGGTGGGG + Intronic
1063895089 10:10671580-10671602 ATCCTCACCAGCATTTGGTGTGG + Intergenic
1070603796 10:77884187-77884209 GTCCTCCCTAGCATTTGGTGTGG - Intronic
1070780969 10:79137446-79137468 CTACTCACCCGGACTAGGTGTGG + Intronic
1070978396 10:80624129-80624151 TTCCTCACTGGAACTTGGTGAGG + Intronic
1084039042 11:66531039-66531061 CTCCTCACTTAGATATGGAGTGG + Intronic
1085277833 11:75311369-75311391 CTCCTTTCTCGGAATTGCTGTGG - Intronic
1087285792 11:96263941-96263963 CTCCTTAGGGGGATTTGGTGAGG + Intronic
1088145386 11:106670695-106670717 ACCCTGACTCAGATTTGGTGAGG - Intergenic
1089869913 11:121663282-121663304 CTCTTCACTTGACTTTGGTGGGG + Intergenic
1091548009 12:1517330-1517352 CCCCACCCTGGGATTTGGTGGGG + Intergenic
1092372699 12:7930360-7930382 CTCCTCACTTGGATTCTGAGAGG + Intronic
1095325832 12:40890988-40891010 ATCCTCACTAGCATTTGATGTGG - Intronic
1098009525 12:66035855-66035877 TTCATCACCCGGCTTTGGTGGGG - Intergenic
1102106839 12:110332279-110332301 CTCATAACTTGGATTTTGTGTGG + Intronic
1110378411 13:74820914-74820936 CTCCTCTCTCAGTTTTAGTGAGG - Intergenic
1120143892 14:80958229-80958251 CTACTTAATTGGATTTGGTGAGG - Intronic
1122149347 14:99716464-99716486 CCCCTCACTCAGAATTTGTGGGG + Intronic
1122956624 14:105074369-105074391 CTCCTCTCTAGGAACTGGTGGGG + Intergenic
1124092016 15:26614254-26614276 CCCCTCACTTGGATTTAATGAGG - Intronic
1125960681 15:43827124-43827146 CTCCTGCCTCGGTTTTTGTGAGG + Intronic
1126431837 15:48594202-48594224 CTCCTCTCTCCCATGTGGTGTGG + Intronic
1126566736 15:50108702-50108724 CTCCTATCTCTGATTTGGGGAGG - Intronic
1128066851 15:64770536-64770558 CTCCTCACTGGGAGTTATTGTGG - Intronic
1128440463 15:67703102-67703124 TTCCTCACAGGGACTTGGTGAGG + Intronic
1133009247 16:2901251-2901273 CTGCTCACTGGGATGTGGTGTGG - Intergenic
1134092543 16:11399280-11399302 TTCCTAACTGGGATGTGGTGAGG - Intronic
1138279349 16:55761182-55761204 TACCTCACTGGGCTTTGGTGAGG + Intergenic
1138289179 16:55832493-55832515 TACCTCACTGGGCTTTGGTGAGG - Intronic
1138669815 16:58604846-58604868 CACCACACCCGGCTTTGGTGTGG - Intronic
1140408933 16:74729820-74729842 ATCCTCACTCCGATTGTGTGTGG - Intronic
1144860801 17:18300489-18300511 TCCTTCACTCGGATGTGGTGCGG - Intronic
1151853870 17:76708381-76708403 CTCCTCCCTCGCTGTTGGTGGGG + Intronic
1157556368 18:48615582-48615604 CACCCCACTCGGAGTTGCTGAGG + Intronic
1157815764 18:50728545-50728567 CTACTCAGTCAGAATTGGTGGGG + Intronic
1158665824 18:59431667-59431689 CTCTTCGCTGGTATTTGGTGGGG + Exonic
1160051188 18:75435261-75435283 CTCCTCACTGGGGGTTGCTGAGG - Intergenic
1163378744 19:16950371-16950393 CCACTCACTCAGTTTTGGTGGGG - Intronic
1163985934 19:20951400-20951422 CTCAGCACTCTGATTTAGTGTGG - Intergenic
1165065313 19:33225279-33225301 CTCCTGACTCGATTTTGCTGCGG - Intronic
926599757 2:14829771-14829793 TTACTCACTCGGTTTTTGTGTGG - Intergenic
927894755 2:26774543-26774565 GTCCTGACTTGGATGTGGTGAGG - Intronic
933812468 2:86041604-86041626 CTGCTCTCTTGGGTTTGGTGTGG - Intronic
936401048 2:112164674-112164696 CTACTCACTCTGATTTTCTGGGG - Intronic
948288766 2:236808595-236808617 CTCCTCCCTTGATTTTGGTGGGG + Intergenic
948379354 2:237542016-237542038 CTCATCACTCTGACCTGGTGTGG - Intronic
1175529713 20:59666127-59666149 CTCCTCACTTGGACTTTCTGTGG + Intronic
1179158638 21:38873822-38873844 CTCCTCTCTCTGATGTGCTGAGG - Intergenic
1179256964 21:39725555-39725577 GTCTTCATTCGGATTTGCTGAGG - Intergenic
1181924512 22:26347779-26347801 CTTCTCACACGGAGTTGGTGCGG + Exonic
954695604 3:52423365-52423387 CTCCTCCATCGGGTTTGGGGAGG + Exonic
970050395 4:11907750-11907772 CTCCTGCCTCTGATTTGGTCAGG - Intergenic
981550699 4:145938051-145938073 CTCCTCACTCTGGGTTGCTGGGG - Intronic
988485479 5:31665142-31665164 CACCTAACCTGGATTTGGTGCGG + Intronic
989075165 5:37557558-37557580 TTCCTCACTTGGTTTTTGTGTGG + Intronic
989093267 5:37756669-37756691 CTCCTCTCTCTTCTTTGGTGAGG - Intergenic
991299119 5:65111898-65111920 CTCCTCTCTGAGATTTGTTGTGG - Intergenic
994710196 5:103256979-103257001 GTCTTCACTCGGATTGGATGTGG - Intergenic
994760600 5:103848052-103848074 TTCCTCACTCAGACTTGGTGAGG - Intergenic
1001546158 5:172571614-172571636 CTCCTGACAGGGATGTGGTGTGG - Intergenic
1002142200 5:177149139-177149161 ATCCTCACCAGCATTTGGTGTGG + Intronic
1004374108 6:15076771-15076793 AGCCTCACTGGGATGTGGTGAGG - Intergenic
1005199824 6:23331555-23331577 CTTCTCACTGGAATTTGATGTGG + Intergenic
1008546524 6:52588568-52588590 CTCGGCACTGGGCTTTGGTGTGG - Intergenic
1014152508 6:118074411-118074433 CTCCTCACACTGATTTGAGGAGG - Intronic
1018763127 6:166907862-166907884 CTCCTCACTGGGATTTCATTTGG + Intronic
1027595037 7:80162761-80162783 CCACACACTGGGATTTGGTGTGG + Intronic
1032754305 7:134873798-134873820 CACCTCACTGGGTTTTTGTGGGG + Intronic
1034983607 7:155494224-155494246 CTCCTCACTCGGATTTGGTGGGG - Intronic
1037979769 8:23243791-23243813 ATCCTCACCAGCATTTGGTGTGG + Exonic
1039425983 8:37486653-37486675 CTCCTTTCTGGGATTTTGTGAGG - Intergenic
1039518790 8:38153875-38153897 CTCCTCCCTCTGATCTGCTGGGG + Intergenic
1040005699 8:42619025-42619047 CTGCTCACTCGCATGGGGTGGGG - Intergenic
1049149689 8:141026639-141026661 CTGCTCACTCCACTTTGGTGGGG - Intergenic
1185935872 X:4256966-4256988 TTCCTCCCTCCGAGTTGGTGGGG + Intergenic
1190579410 X:51876500-51876522 CTCCTCACATGGCTTTGGTGAGG + Intronic
1196209974 X:112985406-112985428 CTCTGCACTCTGATTTGATGAGG + Intergenic
1196457037 X:115898284-115898306 CTCCTCACTGGCATGTAGTGTGG + Intergenic
1197994614 X:132359762-132359784 CTCCCCACTCTGAGTTAGTGAGG - Intergenic