ID: 1034983608

View in Genome Browser
Species Human (GRCh38)
Location 7:155494225-155494247
Sequence GCTCCTCACTCGGATTTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 58}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034983608_1034983619 16 Left 1034983608 7:155494225-155494247 CCCACCAAATCCGAGTGAGGAGC 0: 1
1: 0
2: 0
3: 2
4: 58
Right 1034983619 7:155494264-155494286 CCGTCAGAGCCGAGGGCCGCAGG No data
1034983608_1034983620 24 Left 1034983608 7:155494225-155494247 CCCACCAAATCCGAGTGAGGAGC 0: 1
1: 0
2: 0
3: 2
4: 58
Right 1034983620 7:155494272-155494294 GCCGAGGGCCGCAGGCACCGTGG 0: 1
1: 0
2: 1
3: 11
4: 163
1034983608_1034983617 9 Left 1034983608 7:155494225-155494247 CCCACCAAATCCGAGTGAGGAGC 0: 1
1: 0
2: 0
3: 2
4: 58
Right 1034983617 7:155494257-155494279 TGGATCTCCGTCAGAGCCGAGGG No data
1034983608_1034983616 8 Left 1034983608 7:155494225-155494247 CCCACCAAATCCGAGTGAGGAGC 0: 1
1: 0
2: 0
3: 2
4: 58
Right 1034983616 7:155494256-155494278 CTGGATCTCCGTCAGAGCCGAGG 0: 1
1: 0
2: 0
3: 5
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034983608 Original CRISPR GCTCCTCACTCGGATTTGGT GGG (reversed) Intronic
900945655 1:5830132-5830154 ACTCCTCACTAGGATCTGGGAGG - Intergenic
901228385 1:7628277-7628299 GCTAATCACTAGGCTTTGGTTGG - Intronic
905201311 1:36319151-36319173 GCTCCTTACTTGGCTTTGCTGGG - Exonic
906357842 1:45122831-45122853 GCTCCCCACTCAGCCTTGGTGGG - Intronic
912489507 1:110054152-110054174 CCTCCTCTCTTGGATATGGTTGG + Exonic
913320109 1:117582168-117582190 GCTCCACACTTGGAGTTGCTTGG - Intergenic
913540171 1:119812063-119812085 GCTGCTCACAAGGATTTTGTTGG - Intergenic
919432188 1:197509204-197509226 GCTCCTCTCTTGGAGTTTGTTGG - Intronic
919918765 1:202155524-202155546 GCCACTCACTCGGATGTAGTTGG + Exonic
1064301166 10:14124174-14124196 TCTCCTGACTCTGATCTGGTTGG - Intronic
1064962238 10:20977904-20977926 GCTCATCTCTAGGATTTGCTCGG + Intronic
1090619401 11:128548261-128548283 GCTCTTAACTCTGATTTCGTAGG - Intronic
1091557570 12:1586451-1586473 GCTACTCACTCGGCTGAGGTGGG - Intronic
1106150074 13:27091691-27091713 GCTTCTCACTCTGAATTGGGAGG - Intronic
1107215366 13:37911634-37911656 GCTCCCCACTCGGCTTTTGCTGG - Intergenic
1108798312 13:54061246-54061268 GCTCTTCACTCTGCTTTTGTTGG + Intergenic
1116709185 14:48343311-48343333 GATCTGCACTGGGATTTGGTGGG + Intergenic
1117713595 14:58558019-58558041 GCTCCTCAGGCGGATGAGGTGGG - Intergenic
1120580168 14:86237812-86237834 GCTCCTCACTCAGCTTTTGTTGG - Intergenic
1122451529 14:101812389-101812411 CCTGCTCACTCGGATGGGGTGGG + Intronic
1125180408 15:36876868-36876890 GGTCTTCACTCTGTTTTGGTGGG + Intergenic
1129180634 15:73872611-73872633 GCTCCTGATTCCAATTTGGTTGG + Intergenic
1132066034 15:98732134-98732156 GCACCACACTCCCATTTGGTTGG - Intronic
1135155547 16:20049902-20049924 GCTCCTCACTTAGGTTGGGTTGG - Intronic
1135861466 16:26059672-26059694 ACACCTCACTGGGATTTGATAGG + Intronic
1150044472 17:61899139-61899161 GATTCTCACTCAGATGTGGTAGG - Intronic
1157276195 18:46312615-46312637 GATCATCACTCTTATTTGGTAGG - Intergenic
1158665823 18:59431666-59431688 GCTCTTCGCTGGTATTTGGTGGG + Exonic
1161592825 19:5136500-5136522 GCTCTTCACTCTGCTTTGCTGGG + Intronic
1163178834 19:15584449-15584471 GCCCCTCAATCGGATCTGGGTGG + Intergenic
925895122 2:8465361-8465383 GCTCCTCACATGGGTTTGCTTGG - Intergenic
926158325 2:10470421-10470443 GCTCCTCAGTCGGCTCTGCTAGG + Intergenic
931611772 2:64108971-64108993 GCTCCTCACTTAGCTTTCGTTGG - Intronic
936235125 2:110735781-110735803 GCTCCTCATTGGGATTTGCAGGG + Intronic
946043127 2:216799581-216799603 GCACCTCACTCTGATTTGCGAGG + Intergenic
1184857886 22:47156469-47156491 TCTCCTCCCTCGGACATGGTGGG + Intronic
953802449 3:46035560-46035582 GCTGCCCACTCAGTTTTGGTTGG + Intergenic
957040998 3:75335507-75335529 GCTCCTCACTGGCTGTTGGTGGG - Intergenic
961045803 3:123707162-123707184 GCTCCTCACTGGCTGTTGGTGGG - Intronic
962208079 3:133452076-133452098 TCTCCTCTGTCTGATTTGGTTGG - Intronic
967046715 3:185744193-185744215 GTTCCTCACTTGGCTATGGTAGG - Intronic
969685928 4:8674265-8674287 GCTCATCACAGGGATTTGATGGG - Intergenic
974962665 4:68723034-68723056 GCTCTTGACTTGGATTTTGTTGG - Intergenic
978868731 4:113548387-113548409 GCTCCTCAATCCCTTTTGGTAGG + Intronic
980289054 4:130821663-130821685 TGTCCTCACTTGCATTTGGTGGG + Intergenic
980879029 4:138690680-138690702 GCTCCTAACCCAGGTTTGGTTGG - Intergenic
989002816 5:36778563-36778585 GTTCCTCACTTGTATTTGGCAGG + Intergenic
989428685 5:41326680-41326702 GATCTTCACTCAGATTTGGATGG - Intronic
991391173 5:66144705-66144727 TCTCCTTAGTCGGATTTGGGGGG + Intronic
1003309932 6:4961701-4961723 GCTCCTCACTTGATGTTGGTGGG - Intergenic
1006833412 6:36982724-36982746 GCTCCTCACATGGATATGGATGG - Intronic
1014285708 6:119494873-119494895 TCTCCTCACTCTGATTTTGAAGG - Intergenic
1015654635 6:135503753-135503775 GCCCTTCACTCTGATTTAGTTGG - Intergenic
1019746416 7:2702714-2702736 GCTCCTCGCTCAGGTCTGGTGGG - Exonic
1034983608 7:155494225-155494247 GCTCCTCACTCGGATTTGGTGGG - Intronic
1039518789 8:38153874-38153896 GCTCCTCCCTCTGATCTGCTGGG + Intergenic
1049149690 8:141026640-141026662 GCTGCTCACTCCACTTTGGTGGG - Intergenic
1056886618 9:90449306-90449328 GCCCCTCACTGAGATGTGGTTGG - Intergenic
1060375870 9:123114859-123114881 GCTCCTCTGCCGGATTGGGTAGG - Intronic
1192223930 X:69215675-69215697 GCTCCTCGCTCGGAAATGATTGG + Intergenic
1192308701 X:69990577-69990599 GCTCCCCACTCGGCTTTTGTTGG + Intronic