ID: 1034983609

View in Genome Browser
Species Human (GRCh38)
Location 7:155494226-155494248
Sequence GGCTCCTCACTCGGATTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 68}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034983609_1034983619 15 Left 1034983609 7:155494226-155494248 CCACCAAATCCGAGTGAGGAGCC 0: 1
1: 0
2: 0
3: 7
4: 68
Right 1034983619 7:155494264-155494286 CCGTCAGAGCCGAGGGCCGCAGG No data
1034983609_1034983617 8 Left 1034983609 7:155494226-155494248 CCACCAAATCCGAGTGAGGAGCC 0: 1
1: 0
2: 0
3: 7
4: 68
Right 1034983617 7:155494257-155494279 TGGATCTCCGTCAGAGCCGAGGG No data
1034983609_1034983620 23 Left 1034983609 7:155494226-155494248 CCACCAAATCCGAGTGAGGAGCC 0: 1
1: 0
2: 0
3: 7
4: 68
Right 1034983620 7:155494272-155494294 GCCGAGGGCCGCAGGCACCGTGG 0: 1
1: 0
2: 1
3: 11
4: 163
1034983609_1034983616 7 Left 1034983609 7:155494226-155494248 CCACCAAATCCGAGTGAGGAGCC 0: 1
1: 0
2: 0
3: 7
4: 68
Right 1034983616 7:155494256-155494278 CTGGATCTCCGTCAGAGCCGAGG 0: 1
1: 0
2: 0
3: 5
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034983609 Original CRISPR GGCTCCTCACTCGGATTTGG TGG (reversed) Intronic
904931425 1:34090392-34090414 TGCTCCTCTCTCCGATTTGGGGG + Intronic
906151925 1:43592534-43592556 GGCTGCACGCTCGGATATGGGGG + Exonic
906357843 1:45122832-45122854 GGCTCCCCACTCAGCCTTGGTGG - Intronic
908755920 1:67468654-67468676 GGCTCTGCACTCGGATCTGCAGG + Intergenic
910111609 1:83689626-83689648 GGCTCCTCCCTCGGATTAGATGG + Intergenic
910325952 1:86007256-86007278 GGCACCACACTGGGTTTTGGTGG - Intronic
911369470 1:96979376-96979398 GGCTACTCGCTCAGACTTGGAGG - Intergenic
916011269 1:160708064-160708086 AGCACCTCACTTGAATTTGGGGG + Intronic
917966655 1:180183113-180183135 GTCTCCTCTCTCCGAGTTGGTGG + Intronic
920033147 1:203049233-203049255 GGCTCCACCCCAGGATTTGGAGG + Intronic
1065554885 10:26905624-26905646 GGCCCCACACTCGGATTGGCTGG + Intergenic
1072224626 10:93357103-93357125 TGCACCTCATTCAGATTTGGGGG + Intronic
1076826550 10:132972385-132972407 TGCCCCTCACTCGTGTTTGGCGG - Intergenic
1078743710 11:14091609-14091631 GGCTCCGCACTCGGAGCAGGCGG - Intronic
1083780941 11:64916955-64916977 GGCTCCTCACCCAGATTTCCAGG + Exonic
1090780455 11:130002457-130002479 GGCACCTCACTCGGGGTGGGGGG - Intronic
1100505172 12:95213078-95213100 GGTTTCTCACTAGGATTTGAAGG - Intronic
1103907439 12:124334921-124334943 GGCTCCTCCCATGGATTAGGGGG + Intronic
1104674774 12:130705055-130705077 GGATCCTCACGCAGCTTTGGAGG - Intronic
1110600996 13:77373518-77373540 GGGTCCTCACTCCCATTGGGAGG + Intergenic
1114403705 14:22434135-22434157 GTCTCCTTACTCTGTTTTGGAGG + Intergenic
1116187879 14:41621831-41621853 GGTTCCTTTCTCAGATTTGGAGG + Intronic
1121774612 14:96582571-96582593 GGCTCCTCACACGGTGTCGGAGG + Intergenic
1126038517 15:44569479-44569501 GGCTCCTCACTGGCATTGGAAGG - Exonic
1138187772 16:54989365-54989387 GTCTCCCCATTCGGATCTGGGGG - Intergenic
1142347969 16:89565982-89566004 GGCTCCTCATTCCGTTTTGCAGG + Exonic
1143135277 17:4709323-4709345 GGCTCCGCACTCGGAGTGGCCGG - Intergenic
1143392928 17:6570841-6570863 GGCTCCTCACACTGACTTAGGGG - Intergenic
1147934777 17:44005269-44005291 GGATCCTCACTCGGGCTGGGCGG - Intronic
1152288097 17:79424013-79424035 GGCTCCTGACTCGGACTGAGGGG - Intronic
1161282572 19:3453875-3453897 GGCTCCTCCCTCGGAGGTGGTGG - Exonic
1161592824 19:5136499-5136521 GGCTCTTCACTCTGCTTTGCTGG + Intronic
1161809777 19:6465040-6465062 GGCTCCTAAGTAGGACTTGGGGG + Intronic
932324764 2:70850952-70850974 GTCTTCTCACTGGGAGTTGGGGG - Intergenic
936235124 2:110735780-110735802 GGCTCCTCATTGGGATTTGCAGG + Intronic
948778844 2:240304685-240304707 GCCTCCTCACTCGGCTTGTGGGG - Intergenic
1172175119 20:32967527-32967549 GGCTGCTCACTCGCTATTGGTGG - Intergenic
1174417464 20:50376968-50376990 GGCTCCTCACTTGGCTCTCGTGG + Intergenic
1175121056 20:56716758-56716780 GGCTCCGCATTTGGCTTTGGGGG - Intergenic
1176661076 21:9635301-9635323 GGCTCCTGACTGCGATTTGGTGG + Intergenic
1181940292 22:26470632-26470654 GGCTCCCCACTGTGATCTGGAGG + Intronic
1184674378 22:46032483-46032505 GGCTCTTCACTCTGGTGTGGAGG - Intergenic
1184857885 22:47156468-47156490 GTCTCCTCCCTCGGACATGGTGG + Intronic
1185014293 22:48334281-48334303 GGCTCCTCACAGGGATTCGCAGG + Intergenic
950332685 3:12169011-12169033 GGCTCCTTACTAGGAGTTGGTGG + Intronic
954375334 3:50191555-50191577 GGCTGCTTAGTGGGATTTGGGGG - Intergenic
957040999 3:75335508-75335530 GGCTCCTCACTGGCTGTTGGTGG - Intergenic
961045804 3:123707163-123707185 GGCTCCTCACTGGCTGTTGGTGG - Intronic
962733379 3:138302933-138302955 GGGTTCTCACCCAGATTTGGAGG + Intronic
973728828 4:53803807-53803829 AGCTCCTCTCAGGGATTTGGGGG - Intronic
980015456 4:127645390-127645412 GGCTTCTCACTCACATCTGGTGG - Intronic
985414322 4:189721235-189721257 GGCTCCTGACTGCAATTTGGTGG - Intergenic
986486705 5:8245234-8245256 GGGTCCTGAGTTGGATTTGGAGG + Intergenic
991391172 5:66144704-66144726 CTCTCCTTAGTCGGATTTGGGGG + Intronic
999844514 5:155464201-155464223 GGTTCCACTCTTGGATTTGGAGG + Intergenic
1000621367 5:163489823-163489845 AGCTTCTGACTCGGAGTTGGGGG + Intronic
1005755590 6:28923047-28923069 GCCTCAGCACTCAGATTTGGAGG - Intronic
1007111721 6:39316725-39316747 GGGTGCCCACTGGGATTTGGGGG - Intronic
1013305580 6:108844256-108844278 GGCTCATCCCTCGGGTTTTGGGG - Intergenic
1017630358 6:156391059-156391081 CGCTCCTCATTTGTATTTGGAGG - Intergenic
1019746417 7:2702715-2702737 GGCTCCTCGCTCAGGTCTGGTGG - Exonic
1020469251 7:8517245-8517267 GGTACCTCACCCAGATTTGGAGG + Intronic
1023029686 7:36081301-36081323 GGCCCCTCACAGGGCTTTGGGGG - Intronic
1026878225 7:73891904-73891926 GGCACCCCACTTGGACTTGGGGG + Intergenic
1027056086 7:75050477-75050499 GGCTGATCACTCTGATTTGAAGG + Intronic
1032202166 7:129829750-129829772 GGCTCCTCACTGGGCTTTCATGG - Intergenic
1034983609 7:155494226-155494248 GGCTCCTCACTCGGATTTGGTGG - Intronic
1039518788 8:38153873-38153895 GGCTCCTCCCTCTGATCTGCTGG + Intergenic
1043688037 8:83112857-83112879 AGATCCTCACTCTGATCTGGAGG - Intergenic
1044932125 8:97260576-97260598 GGCTCCCCACTTGGACTTGTGGG + Intergenic
1048715135 8:137260015-137260037 GGCTCCTTACTCAGACATGGGGG + Intergenic
1052862353 9:33444839-33444861 GATTCCCCACTCAGATTTGGAGG + Intronic
1060816144 9:126636283-126636305 GGCTCCTCACCCAGACTTAGGGG + Intronic
1062295353 9:135822431-135822453 GGATTCTGACTCGGATGTGGTGG - Exonic
1203638644 Un_KI270750v1:137145-137167 GGCTCCTGACTGCGATTTGGTGG + Intergenic
1199160696 X:144607595-144607617 GGATCCTAATTCGAATTTGGAGG - Intergenic