ID: 1034983610

View in Genome Browser
Species Human (GRCh38)
Location 7:155494229-155494251
Sequence CAGGGCTCCTCACTCGGATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 62}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034983610_1034983617 5 Left 1034983610 7:155494229-155494251 CCAAATCCGAGTGAGGAGCCCTG 0: 1
1: 0
2: 0
3: 6
4: 62
Right 1034983617 7:155494257-155494279 TGGATCTCCGTCAGAGCCGAGGG No data
1034983610_1034983620 20 Left 1034983610 7:155494229-155494251 CCAAATCCGAGTGAGGAGCCCTG 0: 1
1: 0
2: 0
3: 6
4: 62
Right 1034983620 7:155494272-155494294 GCCGAGGGCCGCAGGCACCGTGG 0: 1
1: 0
2: 1
3: 11
4: 163
1034983610_1034983616 4 Left 1034983610 7:155494229-155494251 CCAAATCCGAGTGAGGAGCCCTG 0: 1
1: 0
2: 0
3: 6
4: 62
Right 1034983616 7:155494256-155494278 CTGGATCTCCGTCAGAGCCGAGG 0: 1
1: 0
2: 0
3: 5
4: 75
1034983610_1034983619 12 Left 1034983610 7:155494229-155494251 CCAAATCCGAGTGAGGAGCCCTG 0: 1
1: 0
2: 0
3: 6
4: 62
Right 1034983619 7:155494264-155494286 CCGTCAGAGCCGAGGGCCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034983610 Original CRISPR CAGGGCTCCTCACTCGGATT TGG (reversed) Intronic
901651390 1:10745106-10745128 CAGGGCTCCTAAGTGGGACTGGG + Intronic
904405875 1:30287613-30287635 CAGGGCCCCTCTCTGGGGTTTGG - Intergenic
905650171 1:39650982-39651004 CAGGGCTCCTCACATGGACTCGG - Intergenic
919973238 1:202594202-202594224 CAAGGCTCCTCACTAGCAGTGGG + Exonic
922529796 1:226335790-226335812 CAGGTCTCTTCACTCAGAGTTGG + Intergenic
923461997 1:234215797-234215819 CAGTGCTCCTCAGTAGGATGGGG - Intronic
1063141133 10:3257519-3257541 CAGGGCTCCACCCTCAGACTTGG + Intergenic
1067759080 10:49029806-49029828 CAGGGCTCCTGCCTCTGATGAGG - Intronic
1081402700 11:42661591-42661613 CAGGCTTGCTCACTCGGATTTGG - Intergenic
1085277115 11:75307347-75307369 CAGGGCTCCTCTCTCAAATAGGG + Intronic
1085792885 11:79511106-79511128 CAGCGCTCCTCACTTGGTTTGGG - Intergenic
1091147347 11:133291356-133291378 CAGGGCTCATCTCTCGGGTTGGG - Intronic
1099190128 12:79553935-79553957 CTGGGCTCCTGAGTCGGATGGGG - Intergenic
1104674775 12:130705058-130705080 CAGGGATCCTCACGCAGCTTTGG - Intronic
1120975056 14:90241048-90241070 AAGGGATCTTCACTCGGATTGGG - Intergenic
1127349684 15:58138185-58138207 CAGGGCCCGTCACTGTGATTTGG + Exonic
1129827225 15:78641719-78641741 CAGGGCCCCTCACCCAGCTTGGG + Intronic
1144793920 17:17878299-17878321 CAGGACTCCTCACTGGGGCTGGG + Intronic
1146594230 17:34155679-34155701 CAGGCCTCCTCCCTCTGACTGGG + Intronic
1148612445 17:48973373-48973395 CAGCCCTCCTCCCACGGATTAGG - Intergenic
1148668543 17:49392894-49392916 GAGGTCTCCTCTCTCGGCTTTGG - Intronic
1150782432 17:68134336-68134358 CAGGGCTCCACACTTGGGTGGGG - Intergenic
1151475799 17:74343828-74343850 CAGGGCTCCTCACTGGGTGGGGG + Intronic
1153581930 18:6582367-6582389 CAGGGCTCCCCACTCCCATCAGG + Intronic
1156431609 18:37080928-37080950 CCGGGCATCTCACTTGGATTTGG - Intronic
1160118828 18:76108880-76108902 CTGGGCTCCCCACTTGGCTTTGG + Intergenic
1164690664 19:30208647-30208669 CAGGGTTCCTCTCTAGCATTTGG - Intergenic
1166950374 19:46423409-46423431 CTGTGCTCCTCACACTGATTCGG - Intergenic
927936213 2:27078344-27078366 CAGGGCTGGTCACTCCGACTGGG - Intergenic
931110773 2:59108885-59108907 GAGGGCTCCACACTCTGAGTGGG + Intergenic
937475611 2:122212424-122212446 CAGGGCTACTGACTCCCATTGGG - Intergenic
944198904 2:197084537-197084559 CAGGGCTTCTGATTTGGATTTGG - Intronic
1173738137 20:45376174-45376196 CTGGGCTCCTCTTTCTGATTTGG - Intronic
1175121059 20:56716761-56716783 CAGGGCTCCGCATTTGGCTTTGG - Intergenic
1183333577 22:37234261-37234283 CAGGGCTCCAAGCTCGGAATAGG + Intronic
1183399716 22:37595329-37595351 CAGGGCTCCTCCCTTGTCTTGGG + Intergenic
949838380 3:8293499-8293521 CTGGGCTCTTCTCTAGGATTTGG + Intergenic
953345496 3:42172036-42172058 CAGGGCTCCTCGTTTGAATTTGG + Intronic
954537441 3:51371794-51371816 CAAGGCCCCTCACACGGATCAGG + Intronic
961142576 3:124567546-124567568 TAGGGCTTCTCACTGGGATTGGG + Intronic
964378601 3:156073570-156073592 CTGGGCTCCTGACTCGGGTGGGG + Intronic
971001206 4:22324610-22324632 CAGAGCTCCCCTCTGGGATTAGG - Intergenic
975251556 4:72185323-72185345 CATGGTTCCTCACACGTATTAGG - Intergenic
979678520 4:123435269-123435291 CTGGGCTCCTGAGTCGGGTTGGG - Intergenic
984663856 4:182404526-182404548 CAGTTCTCCGCACTCTGATTAGG - Intronic
985559937 5:579948-579970 CAGGACTCCTCACTCAGTTCCGG + Intergenic
985628855 5:1004727-1004749 GCGCGCTCCTCACTCGGCTTGGG - Intergenic
993295053 5:86127060-86127082 CAAGGCTCTCCACTGGGATTTGG - Intergenic
994180226 5:96756163-96756185 CAGGTCTCCTCAGTGAGATTTGG + Intronic
995035809 5:107532663-107532685 CAGCCTTCCTCACTCAGATTCGG - Intronic
998769950 5:145531544-145531566 CAGGACTCCTCGCTCAGCTTAGG + Intronic
1002868868 6:1147769-1147791 CGGTGCTCCCCACTCGGATCCGG + Intergenic
1006838063 6:37011134-37011156 CAGGGCTCCTGACTCAGCTCTGG - Intronic
1012249150 6:96960638-96960660 CAGGGGCCCTCACTCATATTTGG - Intronic
1013562509 6:111319800-111319822 CAGGTCTCCTCACTCTCAGTTGG + Intronic
1026175816 7:67995942-67995964 CTGGGCTCCCCAGTGGGATTAGG + Intergenic
1029527916 7:101106594-101106616 CAGGTCTCCTTAATTGGATTTGG + Intergenic
1031887524 7:127256813-127256835 CAGAGTTCCCCACTGGGATTAGG - Intergenic
1034983610 7:155494229-155494251 CAGGGCTCCTCACTCGGATTTGG - Intronic
1037526660 8:19731014-19731036 CAGGGATCCCCACTGGAATTAGG + Intronic
1047503923 8:125463853-125463875 CAGGGCTCTTGTCTGGGATTTGG + Intergenic
1049437442 8:142594300-142594322 CAGGGCTTCCCACTAGGCTTTGG + Intergenic
1051091033 9:13408359-13408381 CAAGGCTCCTCAATCGAACTGGG + Intergenic
1062121007 9:134834037-134834059 CACGGCTCCTCCCTCGGCCTGGG - Intronic
1203453371 Un_GL000219v1:141946-141968 CAGGGATCCTCAGTTGGTTTGGG + Intergenic
1186403102 X:9277816-9277838 CATGCCTCCCCACTGGGATTTGG + Intergenic
1186594284 X:10964236-10964258 CGGGGCCCCTCTCTAGGATTTGG + Intergenic
1197502297 X:127256478-127256500 CTTGGCTCCTCCCTCGGTTTTGG + Intergenic
1199799039 X:151231128-151231150 CAGGGCTCCTGGCTCTGGTTTGG + Intergenic