ID: 1034983611

View in Genome Browser
Species Human (GRCh38)
Location 7:155494235-155494257
Sequence AGGCTGCAGGGCTCCTCACT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 227}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034983611_1034983617 -1 Left 1034983611 7:155494235-155494257 CCGAGTGAGGAGCCCTGCAGCCT 0: 1
1: 0
2: 1
3: 21
4: 227
Right 1034983617 7:155494257-155494279 TGGATCTCCGTCAGAGCCGAGGG No data
1034983611_1034983616 -2 Left 1034983611 7:155494235-155494257 CCGAGTGAGGAGCCCTGCAGCCT 0: 1
1: 0
2: 1
3: 21
4: 227
Right 1034983616 7:155494256-155494278 CTGGATCTCCGTCAGAGCCGAGG 0: 1
1: 0
2: 0
3: 5
4: 75
1034983611_1034983619 6 Left 1034983611 7:155494235-155494257 CCGAGTGAGGAGCCCTGCAGCCT 0: 1
1: 0
2: 1
3: 21
4: 227
Right 1034983619 7:155494264-155494286 CCGTCAGAGCCGAGGGCCGCAGG No data
1034983611_1034983620 14 Left 1034983611 7:155494235-155494257 CCGAGTGAGGAGCCCTGCAGCCT 0: 1
1: 0
2: 1
3: 21
4: 227
Right 1034983620 7:155494272-155494294 GCCGAGGGCCGCAGGCACCGTGG 0: 1
1: 0
2: 1
3: 11
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034983611 Original CRISPR AGGCTGCAGGGCTCCTCACT CGG (reversed) Intronic
900408678 1:2503337-2503359 AGGCTCCAGGGGTCCCTACTGGG + Intronic
900663924 1:3800843-3800865 AGGCTGCCCCTCTCCTCACTAGG + Intergenic
902221925 1:14971849-14971871 AGGCTGCAAGGTTGCTCTCTTGG + Intronic
902823575 1:18957375-18957397 ATGCTGCTCGGCTCCTCAGTGGG - Intergenic
903302632 1:22390237-22390259 AGGCTGCAGGTCTCCTCTGCTGG + Intergenic
905673460 1:39808312-39808334 GGGCGGAGGGGCTCCTCACTTGG - Intergenic
908019589 1:59886381-59886403 AGACTGCAGTGCTTCTCACACGG + Intergenic
908301038 1:62761412-62761434 GGGCTGAAGGGCTCCTCAAGTGG - Intergenic
909511898 1:76462811-76462833 ATGCTGCAGGGATGCTCATTAGG + Intronic
910981563 1:92963531-92963553 CGGCTTCAGGGCACCTCACTCGG - Intergenic
914998316 1:152564115-152564137 AGCCTGCAAAGCTCCACACTTGG - Intronic
916647288 1:166797989-166798011 AGGGTGCAGGGCTCTTGGCTGGG - Intergenic
917904521 1:179575798-179575820 AGGCGGCAGGACTCCGCACAAGG - Exonic
917930676 1:179820640-179820662 AGGCAGCAGGGCCCCCCACAGGG + Intergenic
917931089 1:179823400-179823422 AGGCAGCAGGGCCCCCCACAGGG + Intergenic
920560158 1:206932956-206932978 AGGATTCAAGGCTCCCCACTCGG - Intronic
920662118 1:207923856-207923878 AGGATGCAGGGGTCCTCCCTGGG - Intergenic
922208922 1:223472216-223472238 AGCCTCCAGGTCTCTTCACTAGG + Intergenic
924040148 1:239976575-239976597 ATGCTGCAGGGCTCTGCATTTGG + Intergenic
1063431752 10:5996825-5996847 AGCTTGCAGGGCTTCTCAGTAGG - Intergenic
1063730528 10:8691822-8691844 AGAATGCAGGGCTCCCTACTCGG - Intergenic
1067064158 10:43094219-43094241 AGGCCCCAGGGCTCCTCCCTGGG - Intronic
1067543487 10:47175166-47175188 ATGATGAATGGCTCCTCACTGGG - Intergenic
1067879024 10:50027583-50027605 AGGCAGCTGGGCTCCTTGCTGGG - Intergenic
1069778607 10:70941120-70941142 AGGCAGCAGGGCCCTTCTCTGGG + Intergenic
1069867329 10:71511910-71511932 AGGGTAAAGGGCTTCTCACTGGG + Intronic
1069960190 10:72074952-72074974 AGGCTGCAGGGGTGCTTCCTGGG + Intronic
1070559351 10:77554065-77554087 AGCCCACAGGGTTCCTCACTGGG + Intronic
1072392155 10:94998139-94998161 AGGCAGCAGGGCACCTCCTTAGG + Intergenic
1074314669 10:112350151-112350173 AGGCAGCAGGGTTCCTGAGTTGG + Intergenic
1074355726 10:112781513-112781535 TGGCTCCAGAGCTCATCACTGGG + Intronic
1074819125 10:117165989-117166011 CAGCTGCAAGGCTCCTCCCTGGG + Intergenic
1076264545 10:129099416-129099438 AGGCAGCAGGGCTGCTCCCAGGG - Intergenic
1076421057 10:130331831-130331853 AGGCTGGAGGGCTGGTCCCTAGG + Intergenic
1077764525 11:5144313-5144335 GGGCTGAAGGGCTCCTCAAGTGG - Intergenic
1078660808 11:13283968-13283990 CATCTGCAGAGCTCCTCACTGGG + Intronic
1079103207 11:17554213-17554235 TGGCTGAAGAGCTCCTCACTGGG + Intronic
1080411368 11:32028373-32028395 AGGCTGCATCTCTCCTAACTGGG + Intronic
1081549949 11:44101640-44101662 AAGATGCAGGTCCCCTCACTGGG - Intronic
1081555549 11:44157558-44157580 AGGCTCAAGGGCTCTTCAGTCGG + Intronic
1081609596 11:44552758-44552780 AGCCTGCAGGCTTCCTGACTGGG + Intergenic
1081997990 11:47377132-47377154 GGGCTCCTGGCCTCCTCACTTGG - Intronic
1083681478 11:64353810-64353832 AGGTGACAGGGCTGCTCACTTGG - Exonic
1083716142 11:64578101-64578123 AGGCTGCATGTGCCCTCACTGGG + Intergenic
1084024815 11:66441195-66441217 GGGCTGAAGGGCTCCTCAAGCGG + Intronic
1084765849 11:71307915-71307937 TGTCTGCAGGGCTCTGCACTGGG + Intergenic
1086700344 11:89894694-89894716 GGGCTGCAGGGAGCCTCTCTTGG - Intergenic
1086705826 11:89949832-89949854 GGGCTGCAGGGAGCCTCTCTTGG + Intergenic
1089348793 11:117809443-117809465 AAGCTCCAGGCCTCCGCACTGGG + Intronic
1091850911 12:3696234-3696256 AGGCTGCCGGGCCCTGCACTAGG + Intronic
1094311390 12:29087256-29087278 AGGCTGCAGGGGTCCACCATGGG - Intergenic
1096123485 12:49103643-49103665 AGGCTGCATGGCTTTTCAGTTGG - Intronic
1098076783 12:66739968-66739990 AGGCTGCTGGGCTGCAGACTTGG - Intronic
1098392706 12:69986111-69986133 AGTCAGAAGGGCTCCCCACTTGG - Intergenic
1100722904 12:97377620-97377642 ATGCTTCAGGGCTCCATACTTGG - Intergenic
1102511530 12:113418705-113418727 AGGCTCCAGAGCTCCTGGCTTGG - Intronic
1103955107 12:124571847-124571869 TGGCTCCAGGGATGCTCACTTGG - Intergenic
1104848675 12:131860561-131860583 AGGCTGCAGGGATCCTCCTGTGG - Intergenic
1107357963 13:39588110-39588132 AGGCTGCTGAGCCCCTCACGTGG + Intronic
1107910498 13:45101108-45101130 AGGCTACAGGGCTCTTCAGAGGG - Intergenic
1107978636 13:45713884-45713906 GGGCTGCAGGGCTCCTCGTGGGG - Exonic
1108470930 13:50766328-50766350 AGCCTGCAGGGCTCCAGGCTGGG - Intronic
1108957738 13:56182469-56182491 AATCTGCAGGGCTCCACAGTTGG - Intergenic
1109945252 13:69423853-69423875 AGGTTCCAGGCCTCCCCACTGGG - Intergenic
1113702386 13:112397013-112397035 CGGCTGCAGGGGGCCTCACTGGG + Intronic
1113878940 13:113611936-113611958 AGGCCTCTGGGCTCCTCCCTGGG - Intronic
1117244435 14:53870204-53870226 AGGTTTCATGGCTGCTCACTAGG - Intergenic
1117518477 14:56526429-56526451 AGGCTGCTTGGCTATTCACTAGG - Intronic
1118351434 14:64974786-64974808 TCTCTGCAGGCCTCCTCACTGGG + Intronic
1119892212 14:78191508-78191530 TGCCTGCAGGGGTCCTCCCTGGG - Intergenic
1121307710 14:92917383-92917405 AGTTTGCAGGCCTCCTCAGTGGG - Intergenic
1121494533 14:94382985-94383007 AGGCTGTAGCGATGCTCACTGGG + Exonic
1121703009 14:95970452-95970474 AGGCTCAAGTGCTTCTCACTGGG + Intergenic
1122296524 14:100709197-100709219 AGGCTGCAGTGGGCCTCACGGGG + Intergenic
1123058066 14:105581781-105581803 AGGCGGCAGGCCTCCTCCATGGG - Intergenic
1125414879 15:39442080-39442102 AGACTGCAGGGTTCCCCAGTGGG - Intergenic
1129706123 15:77795641-77795663 AGGCTGCAGGGCTCTGTCCTTGG - Intronic
1132763762 16:1524304-1524326 AGGCTCCAGGGCTCCTGAGTGGG - Intronic
1134265691 16:12690828-12690850 AGGCTCCACGGACCCTCACTTGG + Intronic
1135251452 16:20903660-20903682 AGGCACCAGAGCTCCTCAGTAGG - Intronic
1137575923 16:49600384-49600406 AGGCAGCAAGGACCCTCACTCGG + Intronic
1138223175 16:55270338-55270360 GGACTGCAGGGCTCCTCTGTAGG - Intergenic
1140431956 16:74911783-74911805 GGACTGCAGGGCTCCTAACCTGG + Intronic
1141429945 16:83966264-83966286 GGGCTGCAGGTCTCCTGGCTGGG - Exonic
1141590723 16:85067006-85067028 AGGCTGCTGGGCTCCCCTCTAGG + Exonic
1141615029 16:85205612-85205634 TGGCTCCAGGGCTCTACACTGGG + Intergenic
1142362804 16:89635333-89635355 TGGGTGCAGGGCTCTTCCCTGGG + Intronic
1142473001 17:173458-173480 AGGCTGCAGGGCTGGTCAAATGG + Intronic
1142502033 17:338614-338636 AGGCTGCCGGGCACCTGGCTTGG + Intronic
1143980117 17:10861612-10861634 TGGCTGCAGGTTTCCTCACCCGG + Intergenic
1146258248 17:31404256-31404278 GGGCTGCAGGGCCTCTGACTGGG - Intronic
1147051197 17:37796336-37796358 AGGCTGCAGAGCTCCTTGCATGG + Intergenic
1147419867 17:40317165-40317187 AGGCTGAGAGTCTCCTCACTGGG + Intronic
1147654325 17:42080237-42080259 AGGATCCAGGGGTCCTCACGGGG + Intergenic
1147870801 17:43586127-43586149 AGGCTGTAGGTCTTCTCACTGGG + Intergenic
1148331798 17:46817993-46818015 AGGCTTCAGGGCTCCTCCCGGGG - Intronic
1148508715 17:48149499-48149521 AGGCTGTAGGGCTCCGCAACTGG - Intronic
1150129135 17:62657549-62657571 AAGGTGCAGGGCCCCTCACAAGG - Intronic
1152120843 17:78417399-78417421 GGGCTGCGGGGCTGCTCAGTTGG + Intronic
1152441485 17:80312656-80312678 AGTCTGCAGGGCCCCTCTCTGGG + Intronic
1152698382 17:81807237-81807259 AGCCTGCATGGCTGCTCACCTGG + Intronic
1154255763 18:12779701-12779723 TGCCTGCATTGCTCCTCACTTGG + Intergenic
1157894060 18:51447575-51447597 AGGCTGCAGGGCTGTGCTCTGGG - Intergenic
1158829170 18:61259122-61259144 AGGCTGCAGTGATCATCTCTGGG + Intergenic
1159001453 18:62978808-62978830 AGCATGCAGCGCTGCTCACTGGG - Exonic
1160278056 18:77457840-77457862 TGGCTCCAGGCCTCCTCACAGGG - Intergenic
1160880778 19:1318994-1319016 AGGCCCCAGGGATCCTCATTAGG - Intergenic
1160900012 19:1423086-1423108 AGGCTGCAGGTCTGCTCACGTGG - Intronic
1160944044 19:1633013-1633035 AGGCTTCTGGTCTCCACACTGGG - Intronic
1161015573 19:1981150-1981172 AGCCTCCAGGGCACCCCACTGGG - Exonic
1161570530 19:5028302-5028324 AGGCTACAGGGCTTCTCTGTAGG - Intronic
1161577370 19:5061932-5061954 GGGCTGCACGGCTCCTCCCAAGG - Intronic
1162529605 19:11228346-11228368 AGGATGCAGGTCTCCTGTCTAGG + Intronic
1163418760 19:17202639-17202661 AGGGTGCAGGGCTCCCCACCAGG - Intronic
1163847073 19:19643775-19643797 AGGCTGCAGTGCCCCTGACCTGG + Intergenic
1165822497 19:38685472-38685494 AGGCCACAGGGCTCCTCTCCAGG - Intronic
1166355010 19:42221860-42221882 AGGCTGCAGTGAGCCTCCCTTGG - Intronic
1167298652 19:48666574-48666596 AGATTGCAAGGCTCCTCCCTAGG + Intronic
1167972599 19:53197815-53197837 AGGCTGCAGCGCTGCGCACCAGG - Intergenic
925590905 2:5508031-5508053 AGGGAGCAGGGCTCCTTTCTGGG - Intergenic
925875010 2:8303974-8303996 AGGACACAGGGCTCCTCTCTGGG - Intergenic
926128651 2:10286722-10286744 AGGCTGCAGGGCTCCCGTCGGGG - Intergenic
926328226 2:11803689-11803711 AGGCTGCAGGGTCCCACACATGG - Intronic
926330708 2:11822908-11822930 AGTCTGCAGAGCTCCACCCTAGG - Intronic
926343071 2:11920855-11920877 AGGCTGCAGAACTCCACCCTTGG - Intergenic
926355941 2:12040780-12040802 AGGCTCCAGGACCCCTCACTTGG - Intergenic
927159929 2:20247316-20247338 AGGCTTCAGGGCTCACCCCTAGG - Intergenic
929668224 2:43850158-43850180 AGGCTGCAGTGCTCCAGCCTGGG + Intronic
930619874 2:53632649-53632671 AGCCTGTAGCGCTACTCACTTGG + Intronic
931979064 2:67675290-67675312 AGCCCGGAGGACTCCTCACTTGG - Intergenic
933317008 2:80727435-80727457 GGGCTGAAGGGCTCTTCAGTTGG - Intergenic
933739772 2:85524316-85524338 TGGCTGCAGGGCCCCGCACTGGG - Intergenic
933788200 2:85860910-85860932 AGGCTCTAGGGCTCCTCTCCTGG - Intronic
934785564 2:97002857-97002879 AGGCTGCAGGACTCCAGACTGGG + Intronic
937248582 2:120509801-120509823 ATGCTGCAGCACTCCTCTCTGGG + Intergenic
938163403 2:129006285-129006307 AGCCTGCAGGGCAACACACTCGG + Intergenic
939085756 2:137716242-137716264 AGCCAGCTGGGCTCCTCAGTTGG + Intergenic
939529865 2:143344901-143344923 AGGCTGCAGGGCTGCTCTGCAGG + Intronic
940005100 2:149003120-149003142 ACACTGCAGGGCTCCACTCTTGG - Intronic
940178307 2:150903980-150904002 GGACTCTAGGGCTCCTCACTTGG - Intergenic
941706278 2:168661785-168661807 TGGCTCCCGGGCTCCCCACTGGG + Intronic
941927981 2:170915259-170915281 AGCCAGCAGGGCTCCTGAGTTGG - Intergenic
946896126 2:224326211-224326233 GGGCTGCATTCCTCCTCACTGGG + Intergenic
947100951 2:226620818-226620840 AACCTGCTGGGCTCCTCTCTTGG + Intergenic
947479014 2:230480543-230480565 AGGCAGCTGGGCTTCTCCCTAGG + Intronic
947952979 2:234164104-234164126 AGGCTCCAGGGCTCCCGAGTGGG - Intergenic
948598299 2:239094548-239094570 AGTCTGTAGGGCTACTCGCTGGG - Intronic
1170483896 20:16795464-16795486 AGGATCCAGGGCTCCTAATTAGG - Intergenic
1171312525 20:24156295-24156317 AGACTCCAGTGCTGCTCACTAGG - Intergenic
1173229434 20:41182683-41182705 AGACTGCTGGGCTCCTTACATGG + Exonic
1174462903 20:50695476-50695498 AGGCTGCCGGGCTCCAAACCTGG - Intergenic
1174513164 20:51071216-51071238 GGGCCTCCGGGCTCCTCACTTGG - Intergenic
1175885741 20:62289469-62289491 AGGCTGCAGGCCTTCTAACTAGG + Intronic
1176239756 20:64070432-64070454 GGGCTGGAGGGCTGCTCCCTCGG + Intronic
1179786196 21:43731565-43731587 AGTCAGCAGGGCTGCTCACAGGG + Intronic
1179839089 21:44058711-44058733 AGGCCGCAGGGCTCCGCCCTTGG - Intronic
1180716377 22:17875342-17875364 AGGCTGCAGTGTTCCTCACTTGG - Intronic
1181435295 22:22906906-22906928 AGGCTGTAAGCCTCCTCCCTTGG - Intergenic
1181450617 22:23017480-23017502 GGGCTGAAGGGCTCCTCAAGCGG + Intergenic
1182462176 22:30490840-30490862 GGGTAGCAGGGCTCCTCCCTGGG - Intronic
1183059626 22:35328162-35328184 ACTCTGCAGGGGTCCTCACTTGG + Intronic
1183867672 22:40716766-40716788 AGTCTCCAGGGCTTCTCCCTTGG - Intergenic
1184244522 22:43229061-43229083 AGGCTGCAGACCTCCGCAGTGGG + Exonic
1184273892 22:43399613-43399635 AGGCTCCAGGTCTCCTCCCCGGG - Intergenic
1185142026 22:49107892-49107914 AGGCTGCCTGCATCCTCACTCGG + Intergenic
1185294028 22:50044553-50044575 AGGCTGCAGGGCTCCACCGAGGG - Intronic
950083898 3:10242884-10242906 AGCCTGCAGAGCTCTTCGCTAGG - Exonic
950670002 3:14520261-14520283 AGGGTGCAGGGCTCCGCTCCTGG + Exonic
951336604 3:21430480-21430502 AGCCTGCAGAGCTCTTCCCTGGG - Intronic
953338003 3:42110405-42110427 AGGCTGAGGTGCTCCTCTCTGGG + Intronic
953998985 3:47541440-47541462 GGGCAGCAGGGCTCCTCTCCCGG + Intergenic
960265033 3:115611488-115611510 AAGCTTCAGAGCTTCTCACTTGG + Intergenic
960987984 3:123292761-123292783 TGACTGCAGGGCTCCTCCATGGG - Intronic
961791733 3:129381176-129381198 CGGCTGCAGGGCTGCTCCCCAGG + Intergenic
961805757 3:129488129-129488151 CGGCTGCAGGGCTGCTCCCCAGG + Intronic
962751872 3:138439541-138439563 AGGCTGCAGAGCTCCACGCAGGG - Intronic
962881118 3:139577496-139577518 AGGCTACAGTGCTTCTCACTGGG + Intronic
962921813 3:139957191-139957213 AGGCTGGAGAGCTCATCTCTGGG - Intronic
964378596 3:156073564-156073586 AGCCAGCTGGGCTCCTGACTCGG + Intronic
964551245 3:157887353-157887375 ATTCTGCAGGCCTCCTCTCTGGG - Intergenic
964772503 3:160239221-160239243 AGGCTCCAGGCCACCCCACTGGG - Intronic
966198104 3:177333974-177333996 AGGGTGCAGGTCTCCTGACCTGG + Intergenic
967824844 3:193869790-193869812 CGGCTCCGGGGCTCCTCGCTGGG - Intergenic
968506338 4:973014-973036 AGGCTGCGGGCTTCCTCACCTGG - Intronic
968650733 4:1759307-1759329 AGGCCACAGGGCAGCTCACTGGG + Intergenic
969047569 4:4347801-4347823 AGGCAGCTGTGTTCCTCACTAGG - Intergenic
973144320 4:46805251-46805273 AGGCTGAAGGACTCCTCAAGTGG + Intronic
973333350 4:48931845-48931867 AGTCTCCATGGCTCCTCACAGGG - Intergenic
975160800 4:71121420-71121442 AGCCAGCTGGGCTCCTCAGTGGG + Intergenic
976388199 4:84483393-84483415 AGGCTGCAGGGCCCCGGACCCGG + Intergenic
977103356 4:92846912-92846934 AGGATTCAGGGCTCATCAATGGG - Intronic
980209875 4:129773266-129773288 AGGCAGGAAGGATCCTCACTGGG - Intergenic
981713826 4:147733344-147733366 AGGCTGCCCAGCTCCTCACTGGG - Intronic
982773633 4:159420799-159420821 GGGCTGAAGGGCTCCTCAAGTGG - Intergenic
985575014 5:669942-669964 AGGATGCCGAGCTCCACACTCGG - Intronic
985685363 5:1279122-1279144 AGGCTGAAGGCCTCCACCCTAGG + Intronic
989667438 5:43872813-43872835 TGGCTGCTGTGCTCCTCACCTGG + Intergenic
992086064 5:73279358-73279380 AGACTGCAGGGGTCTTCTCTTGG - Intergenic
993168414 5:84384778-84384800 CGGCTGCGGGGCTTCTGACTTGG + Exonic
996170758 5:120287806-120287828 TGGCTGCCAGGCTTCTCACTTGG - Intergenic
998034440 5:138902389-138902411 AGGGTGCTGGGCACCTCACCAGG + Intronic
1001770615 5:174293279-174293301 CGGGAGCAGGGCTCCTCCCTAGG + Intergenic
1002075579 5:176706327-176706349 AGAATGCAGGGATCCTCTCTAGG - Intergenic
1003007926 6:2398630-2398652 AGGCAGCAGAGCTCCTCAGCAGG + Intergenic
1003897076 6:10617477-10617499 GGGCTGAAGGGCTCCTCAAGTGG + Intronic
1006099803 6:31679570-31679592 AGCCTGCTGGGCTCCCCACTTGG - Intronic
1013472170 6:110475711-110475733 ACGCTGCATGGCCCCTCACCCGG + Intronic
1018391510 6:163345048-163345070 TAGCTCCAGGGCCCCTCACTGGG - Intergenic
1018513716 6:164555152-164555174 AGGGTGGAGGACTCCTTACTTGG + Intergenic
1019011857 6:168849389-168849411 AGGCTGCAGTGCCCCTCGATGGG + Intergenic
1019697018 7:2451722-2451744 GGGCTGGAGGGATGCTCACTCGG - Intergenic
1020009332 7:4799818-4799840 GGGCTGCAGTGGTCCTCGCTGGG - Intronic
1020559770 7:9716603-9716625 AAGCTTCAGGGCCCTTCACTTGG + Intergenic
1021963798 7:25897731-25897753 AGGCTCTAGGGAGCCTCACTAGG - Intergenic
1022464786 7:30646414-30646436 AGGCTGCAGGAGTGCTCACGAGG - Intergenic
1022467435 7:30661147-30661169 AGGCAGCAGCTCCCCTCACTGGG - Intronic
1023925847 7:44669125-44669147 AAGCTGCCGGGCTCCCCACAGGG - Intronic
1024234240 7:47385802-47385824 ATGCTGCTGGGCCCCTGACTAGG - Intronic
1026475238 7:70729299-70729321 GGGCTGCCGGGCTCCTGACCAGG - Intronic
1028582947 7:92425521-92425543 AGGTCGCAGGGCTCCTCCCCAGG - Intergenic
1034983611 7:155494235-155494257 AGGCTGCAGGGCTCCTCACTCGG - Intronic
1035352924 7:158259070-158259092 AGGCATCAGGGGTCCTCACGGGG - Intronic
1039659414 8:39446876-39446898 GGGCTGCAGGTTTCCTCTCTTGG + Intergenic
1045053070 8:98344291-98344313 ATGCTGCAGTCCTCCTCACCTGG + Intergenic
1045187741 8:99856085-99856107 GGGCTGCAGGGCCCGTTACTTGG - Intronic
1047599164 8:126409125-126409147 AGGCTGCATGGCCCCTCTCCAGG + Intergenic
1049452582 8:142670039-142670061 AGGCTGGAGGACTCAGCACTCGG + Intronic
1049542526 8:143215045-143215067 AGGTTGCAGCGCTCGTCCCTGGG - Intergenic
1051196450 9:14566937-14566959 AGACTGCAGGGTTCCTCTTTAGG + Intergenic
1055371597 9:75605621-75605643 AGCATGCAGGGCACCACACTAGG - Intergenic
1056299799 9:85229233-85229255 CTGCTGCAGAGCTCCTCACATGG - Intergenic
1056629108 9:88278076-88278098 AGGCTGCTTGCCTCCTCACCTGG + Intergenic
1056689178 9:88791757-88791779 AGGCTGCAGGCTTCCTCATCTGG - Intergenic
1056831539 9:89921066-89921088 CGGCTGCAGTTCTCCTCACAGGG + Intergenic
1057227194 9:93298587-93298609 AGGCTGCAGTGCTGCTCAGGAGG - Intronic
1057484444 9:95471665-95471687 AGGCTGCAGAGCAGCTCAGTGGG + Intronic
1057705395 9:97391880-97391902 AGGCTGGGGACCTCCTCACTGGG + Intergenic
1057825352 9:98368869-98368891 AGGCTCCTGGGCTCCTCCCAAGG + Intronic
1060796778 9:126517237-126517259 AGGCTGCAGGGCTCAGGAATAGG + Intergenic
1060888190 9:127170844-127170866 AGAATGCAGGCCTCCTCCCTGGG - Intronic
1061216233 9:129223621-129223643 AGGCTGCAGGCCACCTCGCCGGG - Intergenic
1061540438 9:131275474-131275496 AGGCTGCAGGGCTGCCCTCCAGG - Intronic
1186560473 X:10607227-10607249 AGGCTTCAGGTTACCTCACTGGG - Intronic
1190310805 X:49115873-49115895 AGGCTGCAGGGTTCCCACCTTGG + Exonic
1190708420 X:53048953-53048975 AGGGTCCGGGGCTCCTCCCTGGG - Intergenic
1195370374 X:104166885-104166907 AGGCAGCCCGGCTCCTCGCTCGG - Exonic
1195672150 X:107478929-107478951 AGGCTGCTCGGCACCCCACTAGG + Intergenic
1197184351 X:123570210-123570232 AGGGTCCAGGCCTCCCCACTGGG - Intergenic
1198576998 X:138021350-138021372 AGGCCCCAGGGTTCCACACTGGG + Intergenic
1200535981 Y:4398206-4398228 AGGCTCCAGTGCTCTTCATTCGG - Intergenic