ID: 1034983613

View in Genome Browser
Species Human (GRCh38)
Location 7:155494247-155494269
Sequence TGACGGAGATCCAGGCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 143}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034983613_1034983625 24 Left 1034983613 7:155494247-155494269 CCCTGCAGCCTGGATCTCCGTCA 0: 1
1: 0
2: 0
3: 8
4: 143
Right 1034983625 7:155494294-155494316 GTCCAACCACTGCATTTACAGGG 0: 1
1: 0
2: 0
3: 12
4: 93
1034983613_1034983619 -6 Left 1034983613 7:155494247-155494269 CCCTGCAGCCTGGATCTCCGTCA 0: 1
1: 0
2: 0
3: 8
4: 143
Right 1034983619 7:155494264-155494286 CCGTCAGAGCCGAGGGCCGCAGG No data
1034983613_1034983624 23 Left 1034983613 7:155494247-155494269 CCCTGCAGCCTGGATCTCCGTCA 0: 1
1: 0
2: 0
3: 8
4: 143
Right 1034983624 7:155494293-155494315 GGTCCAACCACTGCATTTACAGG No data
1034983613_1034983627 29 Left 1034983613 7:155494247-155494269 CCCTGCAGCCTGGATCTCCGTCA 0: 1
1: 0
2: 0
3: 8
4: 143
Right 1034983627 7:155494299-155494321 ACCACTGCATTTACAGGGTCCGG 0: 1
1: 0
2: 0
3: 9
4: 108
1034983613_1034983620 2 Left 1034983613 7:155494247-155494269 CCCTGCAGCCTGGATCTCCGTCA 0: 1
1: 0
2: 0
3: 8
4: 143
Right 1034983620 7:155494272-155494294 GCCGAGGGCCGCAGGCACCGTGG 0: 1
1: 0
2: 1
3: 11
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034983613 Original CRISPR TGACGGAGATCCAGGCTGCA GGG (reversed) Intronic
901400900 1:9014625-9014647 TGAAGCAGACCCAGGCTTCATGG - Intronic
902878420 1:19354848-19354870 TGTGGGAGAGTCAGGCTGCAGGG + Intronic
903537868 1:24079273-24079295 CCACAGAGGTCCAGGCTGCAGGG - Intronic
905046299 1:35005223-35005245 TGACGGAGCTCCCTTCTGCAAGG - Exonic
907407231 1:54261081-54261103 TGACGGAGCTCCGGGCTGAGTGG - Intronic
907936844 1:59049167-59049189 TGATGTAGATCCAGCCTCCATGG - Intergenic
912234483 1:107834965-107834987 AGACAGAGCTCCAGCCTGCATGG + Intronic
912756230 1:112326762-112326784 TGATGGAAATGGAGGCTGCAGGG - Intergenic
912916779 1:113823343-113823365 AGTGGGAGATCCAGGCTACAGGG + Intronic
920261113 1:204688716-204688738 TCACGGAGTTCCAGGCTTCCTGG - Intergenic
920338320 1:205259597-205259619 TATCGGGGATCCAGGCTGCTGGG + Intronic
920342659 1:205285090-205285112 TGAAGGAGATAGAGGCTGCAGGG + Intergenic
920905176 1:210157364-210157386 CCAGGGAGATCAAGGCTGCAGGG + Intronic
921067951 1:211636152-211636174 TGAAGGAGAACACGGCTGCATGG - Intergenic
922476029 1:225907500-225907522 AGCTGGAAATCCAGGCTGCAGGG - Intronic
922700735 1:227758689-227758711 TGACCCAGATCAAGGCAGCAGGG + Intronic
922797339 1:228346953-228346975 TGACTGTGATCCTGGCTGCTTGG + Intronic
922882945 1:228996348-228996370 TCTTGGAGCTCCAGGCTGCAAGG + Intergenic
1062944453 10:1449979-1450001 TGACGGAGGGGCTGGCTGCAAGG + Intronic
1065139773 10:22708856-22708878 TCCAGGAGGTCCAGGCTGCAGGG - Intronic
1065186632 10:23175001-23175023 AGACGGAGATCCTAGCTGCCGGG + Intergenic
1067711815 10:48656236-48656258 GGACGGAGCTCCCGGCTGCTCGG + Intronic
1072663994 10:97380861-97380883 ACACGGAGCTCCAGGCCGCATGG + Exonic
1076409583 10:130236374-130236396 TTACTGAGATCCCAGCTGCAGGG + Intergenic
1078219324 11:9338239-9338261 CCAAGGAGTTCCAGGCTGCAGGG + Intergenic
1083743905 11:64724735-64724757 AGAGGGGGACCCAGGCTGCAAGG + Intergenic
1091024119 11:132126797-132126819 TGGCAGAGAAACAGGCTGCAAGG - Intronic
1092950430 12:13498541-13498563 TGAGGGAGGTACAGGCTCCAGGG - Intergenic
1095084806 12:38049808-38049830 TGACTGTCATCAAGGCTGCAGGG + Intergenic
1102148887 12:110674869-110674891 GGACTGAGATCCAGCCTGCAGGG + Intronic
1102973487 12:117189981-117190003 TGACGGAGGACCCGGCTGCGAGG + Intronic
1103000750 12:117383708-117383730 AGCCTGAGGTCCAGGCTGCAAGG - Intronic
1103942427 12:124508350-124508372 TGTCTGAGCTCCTGGCTGCAGGG - Intronic
1106396353 13:29384746-29384768 TGAAGGATATCCAGGCTGGCAGG - Intronic
1106852134 13:33805123-33805145 TGACAGAGATGCAGACTGAAAGG + Intergenic
1108571758 13:51758665-51758687 AGACAGAGCTCCAGCCTGCAAGG + Intronic
1110723426 13:78791424-78791446 TGTCTGAAATCCAGGATGCAAGG - Intergenic
1114551351 14:23534467-23534489 GGAGGGAGATGAAGGCTGCAAGG - Exonic
1119894788 14:78210901-78210923 TGCTGTAGATCCAGGCTGCCTGG + Intergenic
1120163467 14:81169996-81170018 AGACAGAGCTCCAGGTTGCAGGG + Intergenic
1121646364 14:95519951-95519973 TGGTGGAGATGCTGGCTGCAGGG - Intergenic
1121702016 14:95961827-95961849 TGAGGGAGCTGCAGGCTGCTTGG + Intergenic
1122875258 14:104660914-104660936 GGAGGGAGACCCAGGCTGCACGG - Intergenic
1128661311 15:69502978-69503000 TGACGGAGATGGAGGCCGCCTGG + Intergenic
1129332059 15:74832745-74832767 TGACAGAGACCCAGATTGCAGGG - Intergenic
1131099891 15:89679564-89679586 TGAAGGAGATCCAGGCTCAGAGG + Intronic
1131392008 15:92057272-92057294 TGACGGGCTGCCAGGCTGCAGGG - Intronic
1135711005 16:24717158-24717180 TCCAGGAGATCAAGGCTGCAAGG - Intergenic
1137561533 16:49505539-49505561 TGACAGACCCCCAGGCTGCAGGG + Intronic
1139576266 16:67844049-67844071 TGATGGAGATCCAGCTTGCCAGG + Exonic
1142492281 17:286813-286835 GGACGCAGTTCCAGGCTGCAGGG - Intronic
1144220289 17:13093676-13093698 TGACAGAGATGCAAGCTGGATGG + Intergenic
1144611993 17:16728121-16728143 GGATGGAGTTCAAGGCTGCAGGG - Intronic
1144900743 17:18587263-18587285 GGATGGAGTTCAAGGCTGCAGGG + Intergenic
1144999279 17:19292191-19292213 TGACAGAGCTCCAAGGTGCAGGG + Intronic
1145131712 17:20358477-20358499 GGATGGAGTTCAAGGCTGCAGGG - Intergenic
1146003259 17:29144311-29144333 TGACGGAGAGCCAGGCTGGCTGG - Intronic
1147836039 17:43332545-43332567 TGAAAGAGACCCAGGCTTCAAGG + Intergenic
1151697444 17:75724742-75724764 TGACGCTGATCAAGGCTGCCAGG - Exonic
1152512728 17:80801424-80801446 GGAAGGAGATGCAGGCTCCAGGG - Intronic
1153809268 18:8737602-8737624 TGACGGAGATCCCAGATGCCTGG - Intronic
1158527339 18:58227038-58227060 GGAGGCAGATACAGGCTGCAGGG - Intronic
1159087572 18:63810938-63810960 TGAGAGACATCCAGGATGCATGG - Intergenic
1160691482 19:462269-462291 TGCAGGGGATCCAGGCTGCTGGG + Intergenic
1163726990 19:18928505-18928527 TGGCCAAGATTCAGGCTGCAGGG + Exonic
1165528548 19:36377469-36377491 CCAGGGAGGTCCAGGCTGCAGGG + Intronic
1166843882 19:45714527-45714549 AGGAGGAGTTCCAGGCTGCAGGG + Intronic
1168710426 19:58496984-58497006 TGTCTCAGCTCCAGGCTGCAGGG + Intronic
925091645 2:1161247-1161269 TGACTGTCATCCAGGCTGGAAGG - Intronic
925598441 2:5583404-5583426 GGAGGGACATCCAGGCTGTACGG - Intergenic
931221775 2:60295112-60295134 AGCCGGAGCTCCAGGCTGGATGG + Intergenic
931348981 2:61471308-61471330 TGACAGAGATCCGGGCTGGGCGG - Intergenic
931970104 2:67576581-67576603 TGACTGAGATGCAGGCCTCAAGG - Intergenic
936966214 2:118129796-118129818 TGATGGAGAACCAGGCTTTAAGG - Intergenic
946803455 2:223446105-223446127 TCCAGGAGATCGAGGCTGCAGGG - Intergenic
947742722 2:232492133-232492155 CGTAGGAGATCCAGGCTGCAGGG - Intergenic
1169123457 20:3110978-3111000 TGAGGGGGCTGCAGGCTGCAGGG - Intronic
1169672287 20:8115842-8115864 TTACTGAGATCCAGCCGGCAGGG + Intergenic
1170375984 20:15700333-15700355 TGAGGGAGCATCAGGCTGCAAGG + Intronic
1174353657 20:49984562-49984584 TGGCTGAGAAACAGGCTGCAGGG - Intronic
1175624730 20:60481061-60481083 TGAGGGAGACCCGGGATGCAGGG + Intergenic
1177223562 21:18224128-18224150 TGACAGAGCTCCAGACTGAAGGG - Intronic
1178755811 21:35348427-35348449 GGATGGAGAAGCAGGCTGCAGGG + Intronic
1179835065 21:44025913-44025935 TGGAGGAGAGCCAGGCTGAATGG + Intronic
1180066763 21:45416250-45416272 GGACAGAGATCCAGGCTGGCCGG - Intronic
1181603389 22:23965592-23965614 CGCAGGAGATCTAGGCTGCAGGG - Intergenic
1181605125 22:23975715-23975737 CGCAGGAGATCTAGGCTGCAGGG + Intronic
1185388470 22:50547130-50547152 CGTCTGAGACCCAGGCTGCAGGG - Intergenic
950658943 3:14454514-14454536 TGCCTGAGATTCAGCCTGCATGG + Intronic
952022544 3:29040725-29040747 TGAAGGAGCTACAGGCTCCATGG - Intergenic
952059752 3:29493310-29493332 TGTGGTAGATCCAGGCTGCCTGG + Intronic
952217825 3:31295264-31295286 TGCAGGGGATCCAGGCTCCAAGG + Intergenic
952972264 3:38659090-38659112 GCACGGAGATCCGGGCTGCCAGG + Intergenic
953111819 3:39949120-39949142 TGAAAGAGATCCAGGCTTGAGGG + Intronic
954334089 3:49906077-49906099 TCATGGAGCTCCAGGCTGGAAGG - Intronic
956193037 3:66625213-66625235 TCCAGGAGATCGAGGCTGCAGGG + Intergenic
959856213 3:111161914-111161936 TGACGGAAATCCAGGCCCAAAGG - Intronic
964334002 3:155635304-155635326 TGGAGGAGATGCAAGCTGCAGGG - Intronic
966851336 3:184166848-184166870 TGTGGGAGACCCAGGCCGCAGGG - Exonic
968541681 4:1171365-1171387 TGAAGGAGATCGAGGCGGCGGGG - Exonic
970945020 4:21681148-21681170 CTAGGGAGATCAAGGCTGCAGGG - Intronic
972948594 4:44289731-44289753 AGACAGAGCTCCAGCCTGCATGG + Intronic
973712188 4:53641155-53641177 TGGAGGAGATCCAAGCTGCTTGG + Intronic
974838195 4:67275311-67275333 TCAGGGAGGTTCAGGCTGCATGG + Intergenic
979625863 4:122844710-122844732 TCCAGGAGATCAAGGCTGCAGGG - Intronic
983445091 4:167840438-167840460 CCACTGAGATCCAGGCTGCTGGG + Intergenic
988969868 5:36456634-36456656 TGACGGTGATCCAGGAGGGAAGG + Intergenic
994511514 5:100709515-100709537 AGACAGAGCTCCAGCCTGCATGG - Intergenic
995225211 5:109692883-109692905 TGCCAGGGATCTAGGCTGCATGG - Intronic
996265505 5:121534876-121534898 AGACAGAACTCCAGGCTGCATGG + Intergenic
997234322 5:132263979-132264001 AGACTGAGATACAGGCTGGATGG + Intronic
997363285 5:133309176-133309198 TGGCAGAGACCCAGGCTCCAGGG - Intronic
997438305 5:133891019-133891041 TGTCTGAGGCCCAGGCTGCAGGG - Intergenic
998763343 5:145456506-145456528 TGTCGGAGATTAAGGGTGCAAGG - Intergenic
1000683227 5:164213418-164213440 TCATGGAGCTCCAGGCTGAAAGG + Intergenic
1000733898 5:164873968-164873990 TTCAGGAGATCAAGGCTGCAGGG + Intergenic
1000907214 5:166977944-166977966 TGACTGAGGGCCAGACTGCAGGG + Intergenic
1001438762 5:171721618-171721640 TGAAGGAGATTCCGGATGCATGG - Intergenic
1001749192 5:174115878-174115900 TGATGGAGCTACAGGCTGGAAGG + Intronic
1008945102 6:57089009-57089031 AGATTGAGATCCAGGCTGCAGGG - Intronic
1016132855 6:140498159-140498181 TGCAGCAGGTCCAGGCTGCAGGG - Intergenic
1017515231 6:155150448-155150470 TGAAGGATTTCCAGGCTGGAAGG + Intronic
1018380438 6:163253930-163253952 TGACGGGGAGCCAGGGTGGACGG + Intronic
1019195536 6:170280300-170280322 GGATGGAGAACCAGGCTGCCAGG + Intergenic
1019551331 7:1604049-1604071 GCTCGGAGCTCCAGGCTGCAGGG + Intergenic
1019746339 7:2702257-2702279 GGACACAGAGCCAGGCTGCATGG - Intronic
1019746349 7:2702314-2702336 GGACACAGAGCCAGGCTGCATGG - Intronic
1020128345 7:5545608-5545630 TCACGGAGTCCCAGTCTGCAGGG - Intronic
1022633213 7:32105611-32105633 TTTAGGAGATCCAGGCTGAATGG - Intronic
1026897175 7:74016408-74016430 TGAGAGAAATCCAGGCTGTAGGG + Intergenic
1029536354 7:101160070-101160092 GGAAGGTGAACCAGGCTGCAGGG - Intronic
1032600294 7:133286746-133286768 TGACGGAGACCGAGGGTCCATGG + Intronic
1034229486 7:149510362-149510384 TAAGGGAGATCCAGTATGCATGG + Intergenic
1034318241 7:150154553-150154575 TGGCTGAGGTCAAGGCTGCAAGG - Intergenic
1034774512 7:153812679-153812701 TGGCTGAGGTCAAGGCTGCAAGG + Intergenic
1034917520 7:155053087-155053109 GGACTGGAATCCAGGCTGCAGGG + Intergenic
1034983613 7:155494247-155494269 TGACGGAGATCCAGGCTGCAGGG - Intronic
1035105049 7:156435079-156435101 TGATGGAAAACCAGGGTGCAGGG + Intergenic
1035759031 8:2055756-2055778 TGTCCGAGACCCAGGGTGCAGGG - Intronic
1036594172 8:10197397-10197419 TGCCGGAGATGCAGGATGCTTGG + Intronic
1038010446 8:23471757-23471779 TTATGGACAGCCAGGCTGCACGG - Intergenic
1046877806 8:119275809-119275831 TGCAGGAGATCCTGGATGCATGG + Intergenic
1048748663 8:137645641-137645663 CGACGGAGCTCCAGGTTGCCAGG - Intergenic
1055559175 9:77505476-77505498 TGAAGGACTTCCAGTCTGCAGGG - Intronic
1057875123 9:98747812-98747834 TGAGGTAGATGCAGGCTGGAAGG - Intronic
1058577641 9:106420854-106420876 TGAGGGGGCCCCAGGCTGCAAGG - Intergenic
1059456681 9:114404147-114404169 TGACGGAGATGGAGGCTGGAAGG + Intronic
1060186269 9:121566047-121566069 AGAGGGAGATGCAGGCTCCACGG - Intergenic
1060593728 9:124835318-124835340 TGGCGGGGAGCCAGGCTACAGGG - Intergenic
1189500230 X:41549762-41549784 TCCAGGAGTTCCAGGCTGCAAGG + Intronic
1198169403 X:134091031-134091053 CCAAGGAGGTCCAGGCTGCAGGG - Intergenic
1199854322 X:151747840-151747862 TGATGGTGAACCAGGCTCCAGGG - Intergenic