ID: 1034983614

View in Genome Browser
Species Human (GRCh38)
Location 7:155494248-155494270
Sequence CTGACGGAGATCCAGGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 158}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034983614_1034983627 28 Left 1034983614 7:155494248-155494270 CCTGCAGCCTGGATCTCCGTCAG 0: 1
1: 0
2: 2
3: 9
4: 158
Right 1034983627 7:155494299-155494321 ACCACTGCATTTACAGGGTCCGG 0: 1
1: 0
2: 0
3: 9
4: 108
1034983614_1034983625 23 Left 1034983614 7:155494248-155494270 CCTGCAGCCTGGATCTCCGTCAG 0: 1
1: 0
2: 2
3: 9
4: 158
Right 1034983625 7:155494294-155494316 GTCCAACCACTGCATTTACAGGG 0: 1
1: 0
2: 0
3: 12
4: 93
1034983614_1034983624 22 Left 1034983614 7:155494248-155494270 CCTGCAGCCTGGATCTCCGTCAG 0: 1
1: 0
2: 2
3: 9
4: 158
Right 1034983624 7:155494293-155494315 GGTCCAACCACTGCATTTACAGG No data
1034983614_1034983619 -7 Left 1034983614 7:155494248-155494270 CCTGCAGCCTGGATCTCCGTCAG 0: 1
1: 0
2: 2
3: 9
4: 158
Right 1034983619 7:155494264-155494286 CCGTCAGAGCCGAGGGCCGCAGG No data
1034983614_1034983620 1 Left 1034983614 7:155494248-155494270 CCTGCAGCCTGGATCTCCGTCAG 0: 1
1: 0
2: 2
3: 9
4: 158
Right 1034983620 7:155494272-155494294 GCCGAGGGCCGCAGGCACCGTGG 0: 1
1: 0
2: 1
3: 11
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034983614 Original CRISPR CTGACGGAGATCCAGGCTGC AGG (reversed) Intronic
900421459 1:2557638-2557660 CAGAGGGAGATTCAGGCTGTGGG + Intronic
900688155 1:3962375-3962397 CTGAGCGAGTTCCAGGCTGGGGG - Intergenic
900862641 1:5244264-5244286 CTCACGGAAATCCTGGCTTCTGG - Intergenic
901228537 1:7629192-7629214 CTGTCAGGGATGCAGGCTGCTGG - Intronic
901613124 1:10515083-10515105 CTGGCACAGATCCATGCTGCTGG - Intronic
902708596 1:18223293-18223315 CTGTCTGAGAGCCAGGCAGCTGG + Intronic
903537870 1:24079274-24079296 CCCACAGAGGTCCAGGCTGCAGG - Intronic
904413640 1:30341603-30341625 CTGGCTGGGATCCAGGCTGCAGG - Intergenic
905042937 1:34975388-34975410 AAGCTGGAGATCCAGGCTGCTGG - Intergenic
910844574 1:91592985-91593007 GAGACAGAGACCCAGGCTGCAGG + Intergenic
912916778 1:113823342-113823364 CAGTGGGAGATCCAGGCTACAGG + Intronic
913529107 1:119720831-119720853 CTGATGGACATCCAGGCTGCAGG + Intronic
919480685 1:198085194-198085216 CTGACAGACATCCAGGTTACTGG + Intergenic
920338319 1:205259596-205259618 ATATCGGGGATCCAGGCTGCTGG + Intronic
920342658 1:205285089-205285111 GTGAAGGAGATAGAGGCTGCAGG + Intergenic
920720410 1:208381628-208381650 CTGGCTAAGACCCAGGCTGCTGG + Intergenic
921051614 1:211515489-211515511 CGGAGGGAGGTCCTGGCTGCGGG - Intergenic
922476030 1:225907501-225907523 CAGCTGGAAATCCAGGCTGCAGG - Intronic
1065186631 10:23175000-23175022 CAGACGGAGATCCTAGCTGCCGG + Intergenic
1069822813 10:71238052-71238074 CTGAGGGAGTTACAGGCTGTTGG - Intronic
1071573874 10:86712052-86712074 GTGACGGCGAGCCAGGCTGAAGG + Intronic
1074357555 10:112799541-112799563 GTGGGGGAGATCCAGTCTGCAGG - Intronic
1076060851 10:127412925-127412947 CTGGAGGAGGTCCAGGGTGCTGG - Intronic
1076123253 10:127953173-127953195 CTGCAATAGATCCAGGCTGCTGG + Intronic
1076998354 11:310401-310423 CTGTCGGCAATCCAGGCTGTCGG + Intronic
1077000388 11:319357-319379 CTGTCGGCAATCCAGGCTGTCGG - Intergenic
1077640827 11:3880006-3880028 CTCATGGAGATCCAGGAAGCAGG + Intronic
1081775484 11:45673531-45673553 CTGTCTGAGAGCCAGGCAGCTGG + Intergenic
1083962049 11:66020139-66020161 CTGACGGAGCTCAGAGCTGCAGG - Exonic
1087687722 11:101284286-101284308 CTGACTGTGAACCAGGCAGCAGG + Intergenic
1089581152 11:119482712-119482734 CTGACTGTGATCCAGGGTTCAGG + Intergenic
1091293321 11:134454642-134454664 TAGACGGAGATCCAAACTGCGGG + Intergenic
1091813974 12:3422108-3422130 CTGAAGGGAATGCAGGCTGCTGG - Intronic
1092229979 12:6770805-6770827 CTGAGGGAGATCCAGGGATCAGG - Exonic
1092936109 12:13366163-13366185 CTGGCCGAGATCCAGGCAGTAGG + Intergenic
1092950431 12:13498542-13498564 CTGAGGGAGGTACAGGCTCCAGG - Intergenic
1095084805 12:38049807-38049829 CTGACTGTCATCAAGGCTGCAGG + Intergenic
1095483845 12:42663797-42663819 CTGAAGGAGGTCCAGCCTTCTGG - Intergenic
1095961602 12:47838428-47838450 CTGACAGTGAGCGAGGCTGCAGG - Intergenic
1096476589 12:51912736-51912758 CTGACAGAGCTCCAGCCTGCAGG - Intronic
1102030248 12:109736178-109736200 ATGAAGGAGCTCCAGGCTGCTGG - Intronic
1102148886 12:110674868-110674890 TGGACTGAGATCCAGCCTGCAGG + Intronic
1103942428 12:124508351-124508373 CTGTCTGAGCTCCTGGCTGCAGG - Intronic
1104972093 12:132535461-132535483 CTGTCAGGGAGCCAGGCTGCAGG - Intronic
1104985766 12:132596177-132596199 CTCACCGAGAGCCAGGCTGCTGG - Intergenic
1105247368 13:18665801-18665823 CTGCAGGATCTCCAGGCTGCTGG - Intergenic
1107522194 13:41194278-41194300 CTGACGGCGAGAAAGGCTGCAGG + Exonic
1113133975 13:107068653-107068675 CAGAGGGAGAGCCAGGCTTCTGG - Intergenic
1114579976 14:23748455-23748477 CCCACAGAGATCCAGGCTGATGG - Intergenic
1117679072 14:58184745-58184767 CTGAAGAAGATCCAGGCTGAAGG + Intronic
1118920667 14:70147008-70147030 CTGGAGGAAATACAGGCTGCTGG - Intronic
1119192742 14:72694282-72694304 CTGATGGGGACCCAGGCTGGGGG - Intronic
1122188337 14:100019486-100019508 CTGGCGGAGCTGGAGGCTGCAGG + Intronic
1125765166 15:42130739-42130761 CTGGAGGAGCTCAAGGCTGCAGG - Intergenic
1128745580 15:70111826-70111848 CCCACGCAGATCCAGACTGCGGG + Intergenic
1129332060 15:74832746-74832768 CTGACAGAGACCCAGATTGCAGG - Intergenic
1129604337 15:77017509-77017531 CTCACGGAGATCCAGGGAGGTGG - Intronic
1133915282 16:10103966-10103988 CTAAGGGAGGTACAGGCTGCTGG - Intronic
1134056755 16:11174897-11174919 CCGACAGCGAGCCAGGCTGCTGG - Intronic
1135592633 16:23715187-23715209 TTCCAGGAGATCCAGGCTGCAGG + Intergenic
1137561532 16:49505538-49505560 CTGACAGACCCCCAGGCTGCAGG + Intronic
1141080297 16:81045481-81045503 CTGACGAAGGTCCAGGCAGCAGG - Exonic
1141445325 16:84054426-84054448 CTCACGGTCAGCCAGGCTGCCGG + Exonic
1141903443 16:87007413-87007435 CTGACGAACATCCAGCCTACTGG + Intergenic
1142431830 16:90032766-90032788 CTGACAGAGATGAAGGCTGAGGG + Exonic
1142492282 17:286814-286836 CGGACGCAGTTCCAGGCTGCAGG - Intronic
1143265426 17:5633376-5633398 CTGACGGAGACACAGGCAGATGG + Intergenic
1144160202 17:12550604-12550626 CTGCCGGTTAGCCAGGCTGCAGG + Intergenic
1147965232 17:44191112-44191134 CTGAAGGAGTTCAAAGCTGCTGG + Exonic
1152339319 17:79715665-79715687 CTGTCTGAGTGCCAGGCTGCGGG - Intergenic
1152474525 17:80509292-80509314 CTGGGGGAGATCAAGGCTGGGGG + Intergenic
1154441474 18:14393320-14393342 CTGCAGGATCTCCAGGCTGCTGG + Intergenic
1158833623 18:61306798-61306820 TTGACTGAGATCTTGGCTGCAGG + Intergenic
1158870058 18:61677668-61677690 CTCACTAAGACCCAGGCTGCTGG + Intergenic
1160691481 19:462268-462290 ATGCAGGGGATCCAGGCTGCTGG + Intergenic
1160917276 19:1503326-1503348 CTGTCTGAGATCCAGGCGCCGGG + Intergenic
1160967578 19:1753404-1753426 CGGGCGGAGAGCGAGGCTGCGGG + Exonic
1161531462 19:4792432-4792454 CTGCAGGATCTCCAGGCTGCCGG - Exonic
1163501415 19:17678722-17678744 CTGGAGGAGGTCCAGCCTGCAGG + Intronic
1163726989 19:18928504-18928526 CTGGCCAAGATTCAGGCTGCAGG + Exonic
1165233020 19:34399273-34399295 CGAAAGGAGCTCCAGGCTGCGGG + Exonic
1165768865 19:38367030-38367052 GTGAGGGAGAGCCAGGCAGCTGG + Intronic
1166052683 19:40269844-40269866 GTCACGGGGCTCCAGGCTGCAGG - Intronic
1166368459 19:42289082-42289104 CTGACGCAGGTCTAGGGTGCAGG + Exonic
1167070914 19:47221600-47221622 CTGACGGAGATGCGGACTCCTGG - Exonic
1168317047 19:55489011-55489033 CTGGTGGGGATCCAGGCTGTTGG + Exonic
1168710425 19:58496983-58497005 CTGTCTCAGCTCCAGGCTGCAGG + Intronic
926045006 2:9703815-9703837 CAGACTCAGATCCAGGCTTCTGG - Intergenic
934301850 2:91781131-91781153 GTGAAGGACATCCAGGCGGCTGG + Intergenic
935147187 2:100403879-100403901 CTGCCCAAGATCCAGGCTCCGGG + Intronic
936674558 2:114700099-114700121 CTGATGGGGATCCAGGCTTTAGG - Intronic
938548050 2:132353001-132353023 CTGAGGGAGATCTGGGCCGCTGG - Intergenic
939861099 2:147421425-147421447 CTCACTAAGTTCCAGGCTGCTGG + Intergenic
942778427 2:179612864-179612886 CTGACTCAGATCCTGGCTCCTGG - Intronic
947742723 2:232492134-232492156 GCGTAGGAGATCCAGGCTGCAGG - Intergenic
949010210 2:241674021-241674043 CTGGTAGAGAGCCAGGCTGCAGG - Intergenic
1171304792 20:24096037-24096059 CTGACGTAGCTCCATGCTGTTGG + Intergenic
1171876919 20:30585773-30585795 CTGAGGGAGATCGGGGCCGCTGG - Intergenic
1174463505 20:50699611-50699633 CCTACAGAGATCCAGGCTGGGGG - Intergenic
1175954996 20:62604661-62604683 CAGCCCGAGATCCCGGCTGCAGG - Intergenic
1176454586 21:6897855-6897877 CTGCAGGATCTCCAGGCTGCTGG - Intergenic
1176521179 21:7825747-7825769 CTTACGGAACTCCAGGGTGCTGG - Exonic
1176832759 21:13762903-13762925 CTGCAGGATCTCCAGGCTGCTGG - Intergenic
1178655199 21:34455759-34455781 CTTACGGAACTCCAGGGTGCTGG - Intergenic
1180814579 22:18781588-18781610 GTGAAGGACATCCAGGCGGCTGG - Intergenic
1181200767 22:21215924-21215946 GTGAAGGACATCCAGGCGGCTGG - Exonic
1181700972 22:24621049-24621071 GTGAAGGACATCCAGGCGGCCGG + Exonic
1182109388 22:27712031-27712053 CTGAGGGAGAATCAGGGTGCTGG - Intergenic
1183688216 22:39374211-39374233 CTCACGGAGGGCCAGGCAGCAGG + Intronic
1185095250 22:48802857-48802879 CTGTGGGAGAGCGAGGCTGCAGG + Intronic
1185388471 22:50547131-50547153 CCGTCTGAGACCCAGGCTGCAGG - Intergenic
1203226149 22_KI270731v1_random:79511-79533 GTGAAGGACATCCAGGCGGCTGG + Intergenic
1203264679 22_KI270734v1_random:7275-7297 GTGAAGGACATCCAGGCGGCTGG - Intergenic
952229864 3:31418684-31418706 CTGGCTGAGCTCCAGGCTGTAGG + Intergenic
953111818 3:39949119-39949141 CTGAAAGAGATCCAGGCTTGAGG + Intronic
955878563 3:63520347-63520369 CTGGTGGAGAAACAGGCTGCTGG - Intronic
956164488 3:66386072-66386094 CTGACGGAGGTGCAGGATGGTGG + Exonic
957255021 3:77825638-77825660 CTGAGGGGCTTCCAGGCTGCTGG + Intergenic
957395963 3:79638521-79638543 CTGTGGGAGGTCCAGGCTGGCGG - Intronic
961330173 3:126133798-126133820 CTGACGGTGGTCCAGGCTGCTGG - Intronic
968541682 4:1171366-1171388 ATGAAGGAGATCGAGGCGGCGGG - Exonic
968591070 4:1459928-1459950 CTGAGGGAGATCCTGGGTGTCGG + Intergenic
979889369 4:126071494-126071516 CTCAGGGATATCAAGGCTGCTGG + Intergenic
981172159 4:141637044-141637066 CTTACGGCGTTCCAGGCTGCTGG + Exonic
983445089 4:167840437-167840459 GCCACTGAGATCCAGGCTGCTGG + Intergenic
985897848 5:2759879-2759901 CTGGCGGGGAGCCTGGCTGCAGG - Intergenic
986531618 5:8742682-8742704 CTGACTGTGATCCAGGAAGCTGG - Intergenic
992125404 5:73634684-73634706 CTGAATCAGTTCCAGGCTGCTGG - Intronic
996081782 5:119265652-119265674 CTGGAGGATATGCAGGCTGCAGG + Intergenic
997149113 5:131472624-131472646 CTGCAGGAGATCAGGGCTGCTGG + Exonic
997438306 5:133891020-133891042 CTGTCTGAGGCCCAGGCTGCAGG - Intergenic
999378044 5:151100650-151100672 ATGAGGAAAATCCAGGCTGCAGG + Intergenic
1004079860 6:12381619-12381641 CTGACTGAGATCCAGGATAAGGG - Intergenic
1008945103 6:57089010-57089032 GAGATTGAGATCCAGGCTGCAGG - Intronic
1016132856 6:140498160-140498182 CTGCAGCAGGTCCAGGCTGCAGG - Intergenic
1016874373 6:148850281-148850303 CAGACGCTGGTCCAGGCTGCTGG - Intronic
1017889598 6:158627613-158627635 CTGACGCCCACCCAGGCTGCCGG - Intronic
1018616337 6:165690441-165690463 CTGGAGGAGAGCCAGGCTGAAGG - Intronic
1019274374 7:168163-168185 GTGGGGGAGCTCCAGGCTGCCGG + Intergenic
1020128346 7:5545609-5545631 CTCACGGAGTCCCAGTCTGCAGG - Intronic
1022503835 7:30898477-30898499 CTGACGGAGAAGCAGGCAGACGG - Intergenic
1023086474 7:36574599-36574621 CTGCCAGAAATGCAGGCTGCAGG - Intronic
1026897174 7:74016407-74016429 CTGAGAGAAATCCAGGCTGTAGG + Intergenic
1028923421 7:96331232-96331254 CTGATGGGGCTCCAGGCTGAGGG - Intergenic
1031499420 7:122494198-122494220 CTGCAGGAGTTCCAGCCTGCTGG + Intronic
1032663950 7:134016295-134016317 TTAACGGAGATCAAGGCTGTAGG + Intronic
1034285296 7:149879979-149880001 CTGAGGGAGGTCCAGGTGGCAGG - Exonic
1034542223 7:151765561-151765583 ATGACGGAGACCCAGGGAGCTGG - Intronic
1034983614 7:155494248-155494270 CTGACGGAGATCCAGGCTGCAGG - Intronic
1035759032 8:2055757-2055779 CTGTCCGAGACCCAGGGTGCAGG - Intronic
1041718988 8:60959454-60959476 CTGATGGAGCTGCAGGATGCTGG - Intergenic
1045436632 8:102170890-102170912 CTGAAGTAGATTCAGGCTGAGGG + Intergenic
1047177546 8:122555785-122555807 CTGGAGGAGATCAAGGCTCCAGG + Intergenic
1049573911 8:143381885-143381907 GTGACGGAGCTGAAGGCTGCGGG + Exonic
1057272566 9:93659143-93659165 CTGACGGAGGTGGTGGCTGCAGG - Intronic
1057588075 9:96347342-96347364 CTGACAGTGACCCAGGCTTCCGG - Intronic
1057853211 9:98581151-98581173 CAGAGGCAGATCCAGGCTGTGGG + Intronic
1060593729 9:124835319-124835341 CTGGCGGGGAGCCAGGCTACAGG - Intergenic
1060939618 9:127535926-127535948 CTGAGGGAGCGCCATGCTGCAGG + Intronic
1061728780 9:132597252-132597274 CTGGAGGAGGTCCAAGCTGCTGG + Intronic
1186349596 X:8729163-8729185 CTGGCGGGCATCCAGGCTGGAGG + Intronic
1188981424 X:36730577-36730599 GTGAGGGAGATCCAGGCTAAGGG - Intergenic
1192619408 X:72662454-72662476 CTGACGGAGAAACAGCCTGATGG + Intronic
1195410793 X:104566463-104566485 CTAACGGAGGTGCAGGCGGCAGG - Exonic
1199854323 X:151747841-151747863 CTGATGGTGAACCAGGCTCCAGG - Intergenic
1202114367 Y:21456195-21456217 CAGACTGAGATCCAGGCATCAGG - Intergenic
1202162523 Y:21950529-21950551 CAGACTGAGATCCAGGCATCAGG + Intergenic
1202228833 Y:22635839-22635861 CAGACTGAGATCCAGGCATCAGG - Intergenic
1202314323 Y:23560328-23560350 CAGACTGAGATCCAGGCATCAGG + Intergenic
1202556479 Y:26110267-26110289 CAGACTGAGATCCAGGCATCAGG - Intergenic