ID: 1034983619

View in Genome Browser
Species Human (GRCh38)
Location 7:155494264-155494286
Sequence CCGTCAGAGCCGAGGGCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034983611_1034983619 6 Left 1034983611 7:155494235-155494257 CCGAGTGAGGAGCCCTGCAGCCT 0: 1
1: 0
2: 1
3: 21
4: 227
Right 1034983619 7:155494264-155494286 CCGTCAGAGCCGAGGGCCGCAGG No data
1034983608_1034983619 16 Left 1034983608 7:155494225-155494247 CCCACCAAATCCGAGTGAGGAGC 0: 1
1: 0
2: 0
3: 2
4: 58
Right 1034983619 7:155494264-155494286 CCGTCAGAGCCGAGGGCCGCAGG No data
1034983607_1034983619 17 Left 1034983607 7:155494224-155494246 CCCCACCAAATCCGAGTGAGGAG 0: 1
1: 0
2: 0
3: 4
4: 85
Right 1034983619 7:155494264-155494286 CCGTCAGAGCCGAGGGCCGCAGG No data
1034983610_1034983619 12 Left 1034983610 7:155494229-155494251 CCAAATCCGAGTGAGGAGCCCTG 0: 1
1: 0
2: 0
3: 6
4: 62
Right 1034983619 7:155494264-155494286 CCGTCAGAGCCGAGGGCCGCAGG No data
1034983614_1034983619 -7 Left 1034983614 7:155494248-155494270 CCTGCAGCCTGGATCTCCGTCAG 0: 1
1: 0
2: 2
3: 9
4: 158
Right 1034983619 7:155494264-155494286 CCGTCAGAGCCGAGGGCCGCAGG No data
1034983613_1034983619 -6 Left 1034983613 7:155494247-155494269 CCCTGCAGCCTGGATCTCCGTCA 0: 1
1: 0
2: 0
3: 8
4: 143
Right 1034983619 7:155494264-155494286 CCGTCAGAGCCGAGGGCCGCAGG No data
1034983609_1034983619 15 Left 1034983609 7:155494226-155494248 CCACCAAATCCGAGTGAGGAGCC 0: 1
1: 0
2: 0
3: 7
4: 68
Right 1034983619 7:155494264-155494286 CCGTCAGAGCCGAGGGCCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034983619 Original CRISPR CCGTCAGAGCCGAGGGCCGC AGG Intronic
No off target data available for this crispr