ID: 1034985428

View in Genome Browser
Species Human (GRCh38)
Location 7:155510177-155510199
Sequence TGTGAATGTAGCGCGGCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 27
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 24}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034985428_1034985436 25 Left 1034985428 7:155510177-155510199 CCAGCGGCCGCGCTACATTCACA 0: 1
1: 0
2: 0
3: 2
4: 24
Right 1034985436 7:155510225-155510247 CTCCGCGCTTCACCGCCATCTGG No data
1034985428_1034985433 -10 Left 1034985428 7:155510177-155510199 CCAGCGGCCGCGCTACATTCACA 0: 1
1: 0
2: 0
3: 2
4: 24
Right 1034985433 7:155510190-155510212 TACATTCACAGGCGCGCTCGGGG 0: 1
1: 0
2: 0
3: 0
4: 24
1034985428_1034985434 0 Left 1034985428 7:155510177-155510199 CCAGCGGCCGCGCTACATTCACA 0: 1
1: 0
2: 0
3: 2
4: 24
Right 1034985434 7:155510200-155510222 GGCGCGCTCGGGGCGCACAAAGG No data
1034985428_1034985435 1 Left 1034985428 7:155510177-155510199 CCAGCGGCCGCGCTACATTCACA 0: 1
1: 0
2: 0
3: 2
4: 24
Right 1034985435 7:155510201-155510223 GCGCGCTCGGGGCGCACAAAGGG 0: 1
1: 0
2: 0
3: 2
4: 24

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034985428 Original CRISPR TGTGAATGTAGCGCGGCCGC TGG (reversed) Intronic
922748241 1:228059171-228059193 AGTAGGTGTAGCGCGGCCGCAGG - Exonic
924233198 1:241979226-241979248 TGAGAATGTAACGCCGCCCCTGG + Intergenic
1083853168 11:65379411-65379433 TGTGCATGTAGCTGGGCGGCTGG + Exonic
1087777365 11:102268697-102268719 GGAGAAAGCAGCGCGGCCGCAGG - Intergenic
1107675037 13:42786837-42786859 TGTGAATGTAGCGGGTCTGCAGG - Exonic
1122904226 14:104794742-104794764 AGTGAATGTGGGGCGGCCTCTGG + Intronic
1125201191 15:37101746-37101768 AGTGATTGACGCGCGGCCGCCGG - Intergenic
1132514540 16:360061-360083 TGTGCAGGTATCGGGGCCGCTGG - Intergenic
1133324254 16:4933924-4933946 TGTGAATGATAAGCGGCCGCAGG - Intronic
1139834933 16:69830622-69830644 TGTGAGTGTTGGGGGGCCGCGGG + Intronic
1151506068 17:74527959-74527981 TGAGAATCTAATGCGGCCGCTGG - Intronic
926035545 2:9632553-9632575 TGTGTCTGTAGCGGGGCCCCAGG - Intergenic
934708279 2:96499725-96499747 TGGGAATGTGGCTCGGCCGAGGG - Intronic
938113928 2:128590787-128590809 TGGGAATGTAGTGGGGCCCCGGG + Intergenic
1173517967 20:43678510-43678532 TGTGAATGTAGCCGGGCTTCAGG + Intronic
1176243035 20:64083823-64083845 TGCGGGTGTAGCGCAGCCGCAGG + Exonic
969480716 4:7445522-7445544 TGTGGATGGAGCGGGGCCGAGGG + Intronic
969875714 4:10134249-10134271 GGTGAATGTAGCGTGGGCGTGGG + Intergenic
976090908 4:81456620-81456642 CCTGAATTTAGCGCGGCTGCTGG - Intronic
997653022 5:135536051-135536073 GGTGAATGGAGCGAGGCGGCAGG + Intergenic
1027239535 7:76318204-76318226 TGTGTATGTAGCCCCGCCCCGGG - Intergenic
1034985428 7:155510177-155510199 TGTGAATGTAGCGCGGCCGCTGG - Intronic
1038644495 8:29350880-29350902 CTTGAATGGAGCGCGGCCGCTGG + Intergenic
1050594479 9:7192448-7192470 TGGGAATGGAGCGTGGCAGCTGG + Intergenic
1059417028 9:114168603-114168625 TGTGATGGTTGAGCGGCCGCAGG - Exonic
1189731731 X:44028039-44028061 TGTGAATGTGACGAGGCAGCAGG - Intergenic
1190708633 X:53049817-53049839 TGTGAAGGGAACACGGCCGCCGG - Intronic