ID: 1034986340

View in Genome Browser
Species Human (GRCh38)
Location 7:155517734-155517756
Sequence CACTTTTATCCACTGGCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 112}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034986336_1034986340 -3 Left 1034986336 7:155517714-155517736 CCTGAATGCTAGCCTGGCTTCAC 0: 1
1: 0
2: 0
3: 12
4: 115
Right 1034986340 7:155517734-155517756 CACTTTTATCCACTGGCCATGGG 0: 1
1: 0
2: 1
3: 8
4: 112
1034986332_1034986340 8 Left 1034986332 7:155517703-155517725 CCGCCCAAACACCTGAATGCTAG 0: 1
1: 0
2: 0
3: 5
4: 93
Right 1034986340 7:155517734-155517756 CACTTTTATCCACTGGCCATGGG 0: 1
1: 0
2: 1
3: 8
4: 112
1034986333_1034986340 5 Left 1034986333 7:155517706-155517728 CCCAAACACCTGAATGCTAGCCT 0: 1
1: 0
2: 0
3: 10
4: 86
Right 1034986340 7:155517734-155517756 CACTTTTATCCACTGGCCATGGG 0: 1
1: 0
2: 1
3: 8
4: 112
1034986334_1034986340 4 Left 1034986334 7:155517707-155517729 CCAAACACCTGAATGCTAGCCTG 0: 1
1: 0
2: 0
3: 9
4: 112
Right 1034986340 7:155517734-155517756 CACTTTTATCCACTGGCCATGGG 0: 1
1: 0
2: 1
3: 8
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034986340 Original CRISPR CACTTTTATCCACTGGCCAT GGG Intronic
909228269 1:73053740-73053762 CTCTTTCATCCCCTGGCAATTGG + Intergenic
912280044 1:108303863-108303885 CACTTTTACTCACTGGACAGGGG - Intergenic
912288182 1:108390494-108390516 CACTTTTACTCACTGGACAGGGG + Intronic
918437225 1:184527909-184527931 CAGTTTTATCCCATGGACATTGG + Intronic
918477299 1:184938889-184938911 GCAGTTTATCCACTGGCCATGGG - Intronic
921542087 1:216428959-216428981 CACTCCTATCCACTGGACTTGGG + Intergenic
1064701385 10:18024513-18024535 CACTCTTCTCCACTCTCCATGGG + Intronic
1067148863 10:43713248-43713270 CACTATCATCCACTATCCATTGG + Intergenic
1067328243 10:45290472-45290494 CAGTTTTATCCAATGGGTATTGG - Intergenic
1067666447 10:48283520-48283542 CACTTTTAGCCCCAGGCCATGGG - Intergenic
1071820397 10:89274128-89274150 CACTTTTGTCCAAGGGCCACTGG - Intronic
1073817230 10:107221566-107221588 CACATTTATTCACAGGCCCTTGG + Intergenic
1077889856 11:6411132-6411154 CTCTTTTAGCCACTTGGCATTGG + Exonic
1079811617 11:25004627-25004649 CACTTTCCTCGACTGGCTATGGG - Intronic
1080885513 11:36363952-36363974 CATTTTTAGCCACTGGTCTTGGG + Intronic
1084932019 11:72563509-72563531 CACTTTCACACAGTGGCCATGGG - Intergenic
1085723824 11:78936589-78936611 CACTTTTCTGCACTAGCTATGGG + Intronic
1086928789 11:92669746-92669768 CACTTCTAGCCACAGGCCCTGGG + Intronic
1088196402 11:107278771-107278793 CACTTTGAACCACTGGCTGTGGG + Intergenic
1089041992 11:115460805-115460827 CACTTATATCAACTGGACACTGG + Intronic
1089312210 11:117566042-117566064 CATTTGTAAGCACTGGCCATGGG + Intronic
1092158560 12:6301936-6301958 CACTTGTATCCACTCCCCACAGG + Intergenic
1095466271 12:42490801-42490823 CATTTTTTTTCACTGCCCATGGG + Intronic
1098118269 12:67204325-67204347 CACTTGGTTCCACTGGCCAATGG + Intergenic
1099802933 12:87479888-87479910 CAGTTTCCACCACTGGCCATTGG + Intergenic
1100728230 12:97433400-97433422 CAATTTTATCCTCAGGGCATAGG + Intergenic
1103225802 12:119286620-119286642 CTGTTTTCTCCACTGTCCATTGG - Intergenic
1104539927 12:129654704-129654726 AGCATTTATCCACTGGCCTTGGG - Intronic
1108536717 13:51388772-51388794 TCCTTATATCCACTGGCTATTGG + Intronic
1115926507 14:38441699-38441721 AACTTTTACCCAATGACCATTGG - Intergenic
1116095611 14:40363291-40363313 CACTTTTAACCGCTGGTCACTGG + Intergenic
1121883900 14:97525189-97525211 CACTTTTATCTCCTGGCATTGGG + Intergenic
1125886996 15:43236592-43236614 CACTTTTATCCCCTTGCTCTGGG + Intronic
1126097178 15:45097916-45097938 CACTTGTCTATACTGGCCATGGG - Intronic
1126230717 15:46320420-46320442 AACTTTATTCCACGGGCCATTGG - Intergenic
1128617522 15:69121727-69121749 CACTTTTCTCCACTTTCCAGAGG - Intergenic
1129898879 15:79130296-79130318 CACTCCCATCCACTGGTCATAGG - Intergenic
1129899113 15:79131941-79131963 CACTCCCATCCACTGGTCATAGG - Intergenic
1138042923 16:53693792-53693814 TACTTTTGTGCACAGGCCATTGG - Intronic
1138293698 16:55869186-55869208 CACTTCTGTTCACTCGCCATTGG - Intronic
1138766234 16:59608410-59608432 CACTTTTCTCCACTGGACTTTGG - Intergenic
1139422855 16:66859631-66859653 CCCTTACATCCACAGGCCATGGG + Intronic
1152304224 17:79511849-79511871 CACGTGTGTCCCCTGGCCATGGG - Intronic
1154174158 18:12072956-12072978 CAATTTGAACCACAGGCCATAGG - Intergenic
1156195218 18:34767391-34767413 CATTTTTATCCACTGGGGCTGGG - Intronic
1159638072 18:70830132-70830154 AAATTTTTCCCACTGGCCATTGG + Intergenic
1163903762 19:20132608-20132630 CATTTTTACCAAGTGGCCATAGG + Intergenic
1163940574 19:20489473-20489495 CATTTTTACCAAGTGGCCATGGG - Intergenic
1163956418 19:20646426-20646448 CATTTTTACCAAGTGGCCATGGG + Intronic
1164094036 19:21988928-21988950 CATATTTATCAACTGGACATGGG + Intronic
925667044 2:6268930-6268952 GACTTTTTTCCAATGACCATAGG + Intergenic
927137671 2:20108837-20108859 CCCTTTTACTCACTAGCCATGGG - Intergenic
929440120 2:41959134-41959156 CACTTCTATCCACTTTCTATGGG - Intergenic
929882764 2:45851697-45851719 CTCTTGTAGCCTCTGGCCATGGG - Intronic
930886209 2:56330084-56330106 CACTTTTATCCTCTGGCATTAGG + Intronic
933351003 2:81152088-81152110 CATTTTTAGCCAATGGCTATTGG + Intergenic
938952514 2:136268217-136268239 CACTTATCTCCACAGCCCATTGG - Intergenic
939469269 2:142598892-142598914 CACTTATACCCACAGCCCATAGG + Intergenic
943453791 2:188077809-188077831 CACTGTTTTCAACTGACCATTGG + Intergenic
945514671 2:210748567-210748589 CACTGTGATCAACTAGCCATAGG + Intergenic
1170440645 20:16375788-16375810 GAGTCTTTTCCACTGGCCATTGG - Intronic
1170963992 20:21050321-21050343 CATTTTTATCCACTAGATATAGG + Intergenic
1171126495 20:22606464-22606486 CAACTTTATCCCCTGGCCACAGG + Intergenic
1172095535 20:32458360-32458382 CACTTTTCTCCACTGTCCCTAGG + Intronic
1175601128 20:60274133-60274155 CAATTTTATCCTCTTCCCATGGG + Intergenic
1175642285 20:60640941-60640963 CACTTGTTGCCACTGCCCATGGG - Intergenic
1177726763 21:24978983-24979005 CTCTTTTATCCACAGGGGATAGG + Intergenic
951216704 3:20032025-20032047 CATTTTTATACACTGGGGATAGG + Intergenic
956028294 3:65007814-65007836 CACTTCTGTCCACAGCCCATTGG + Intergenic
957702436 3:83733950-83733972 GACTTTTGGCCACTTGCCATAGG - Intergenic
959070964 3:101701801-101701823 CACTGGTATCCAGGGGCCATAGG + Intergenic
959634566 3:108549688-108549710 CACTTTTAGCCACTGGCTATGGG + Intergenic
962141140 3:132792056-132792078 CACTTCTATCCACATTCCATTGG + Intergenic
963827948 3:149975184-149975206 CACTTTCATCCTCTGACAATGGG + Intronic
963863349 3:150333345-150333367 AACTTTAAGCCAATGGCCATTGG + Intergenic
967645149 3:191913867-191913889 AACTTTTATCCACTCACAATTGG + Intergenic
969855953 4:9999781-9999803 CTCTTTCATCCACTTGCCAGAGG - Intronic
973794638 4:54411966-54411988 CACTTTTATCCTCAATCCATTGG + Intergenic
974515634 4:62904893-62904915 CACTTTTATTCACATCCCATCGG - Intergenic
974872924 4:67665791-67665813 AACTTTTATCCATTTGCAATAGG - Intronic
979727701 4:123984031-123984053 CTCTCTTATCCACTTGACATTGG - Intergenic
979956007 4:126955118-126955140 CACTTTTATTCACATACCATTGG - Intergenic
985360280 4:189168572-189168594 TACTTTTATCCACTGGTCAAAGG + Intergenic
985845939 5:2346970-2346992 TACTTTTCTCCACTCTCCATGGG + Intergenic
986326413 5:6678523-6678545 CACTTTTCTCCTCTGGCCTTTGG + Intergenic
987724641 5:21681798-21681820 CACTTTTATTGACTGCCCTTGGG - Intergenic
987963211 5:24837529-24837551 CACTTTTATATCCTGGCCACAGG + Intergenic
989800051 5:45526399-45526421 CAGTTTCAGCCACTGGCCTTCGG + Intronic
990104152 5:52235852-52235874 CACTTTCATTCAGTGACCATAGG - Intergenic
990798133 5:59567274-59567296 CACCTTTAGCAACTGGACATTGG - Intronic
994087401 5:95774685-95774707 CACTTTCATACACTGCCAATGGG - Intronic
994156566 5:96510255-96510277 CACATTCATCCAATGGCCTTTGG + Intergenic
994950522 5:106455405-106455427 CACTTTTATTCAGGGGTCATTGG + Intergenic
997081260 5:130741419-130741441 CACCTTAAGACACTGGCCATTGG + Intergenic
1001026289 5:168226900-168226922 CACTTTTATCCTCTGACAACGGG - Intronic
1002027316 5:176404387-176404409 CACTTTTTTCCACAGCCCTTTGG + Intronic
1002205234 5:177558258-177558280 CACTTTTACTCACGCGCCATTGG + Intergenic
1002395869 5:178953903-178953925 TATTTTTATCCACTGAGCATTGG + Intronic
1003681018 6:8257100-8257122 CACTTCTATCCACATCCCATTGG + Intergenic
1004539569 6:16537295-16537317 CACTTTTATCCTGTGGCGGTTGG - Intronic
1013766388 6:113578921-113578943 CACTTCTACACACTTGCCATTGG - Intergenic
1021024217 7:15643870-15643892 CAGTTTTGTCCTCTGGCCCTCGG + Intronic
1021957478 7:25840394-25840416 CACTTGTATGCACCGGCCCTGGG + Intergenic
1026446717 7:70491021-70491043 CAGTTTCATCCACTGGTCACAGG + Intronic
1030698937 7:112617613-112617635 CACTTTTATCTACTGTCAACTGG - Intergenic
1031631660 7:124050401-124050423 CACTTTCATCCCCAGCCCATTGG + Intergenic
1031962485 7:128002605-128002627 CAGTGTTCTCCACTTGCCATAGG + Intronic
1034986340 7:155517734-155517756 CACTTTTATCCACTGGCCATGGG + Intronic
1038213438 8:25540651-25540673 CTCTTTTGTCACCTGGCCATGGG + Intergenic
1044720445 8:95140465-95140487 CACTTTATTACACAGGCCATGGG - Intronic
1047219669 8:122909553-122909575 CACTCTTATTCACTCGCCTTGGG + Intronic
1048253655 8:132888101-132888123 CACTTGTCTCCACTGCCCATCGG - Exonic
1052107663 9:24539101-24539123 CACTTTTACCCACAGTCCATTGG + Intergenic
1053536999 9:38936077-38936099 CCCCTTTCTCGACTGGCCATGGG - Intergenic
1054629136 9:67427853-67427875 CCCCTTTCTCGACTGGCCATGGG + Intergenic
1059429898 9:114243640-114243662 CCCTTTTCACAACTGGCCATGGG - Intronic
1060222056 9:121769639-121769661 CATTTGTATCCACTTGCCTTTGG + Intronic
1186747000 X:12580202-12580224 GAGTTTTAGCCACTGGACATGGG - Intronic
1188024224 X:25192053-25192075 CACTGGTATCCAATGGACATAGG + Intergenic
1198486912 X:137096365-137096387 CACTTTCCTCATCTGGCCATTGG - Intergenic
1200147001 X:153931528-153931550 CACTTTTTTCCACTGTCTACTGG + Intronic
1201675840 Y:16583219-16583241 CACTTTTGTCCACTGGCATAGGG + Intergenic