ID: 1034986850

View in Genome Browser
Species Human (GRCh38)
Location 7:155521544-155521566
Sequence GGCTGCCGCCTGGCGATTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 70}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034986850_1034986853 0 Left 1034986850 7:155521544-155521566 CCTGAAATCGCCAGGCGGCAGCC 0: 1
1: 0
2: 1
3: 5
4: 70
Right 1034986853 7:155521567-155521589 TCCCTCTTATACAGAGTCCCTGG 0: 1
1: 0
2: 0
3: 13
4: 99
1034986850_1034986855 1 Left 1034986850 7:155521544-155521566 CCTGAAATCGCCAGGCGGCAGCC 0: 1
1: 0
2: 1
3: 5
4: 70
Right 1034986855 7:155521568-155521590 CCCTCTTATACAGAGTCCCTGGG 0: 1
1: 0
2: 1
3: 5
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034986850 Original CRISPR GGCTGCCGCCTGGCGATTTC AGG (reversed) Intronic
900511662 1:3063686-3063708 GGCTCCCACCTGGCGACTCCCGG + Intergenic
900543998 1:3218397-3218419 GGCTGCCCCCTGGGGATACCTGG - Intronic
904419327 1:30381467-30381489 GACTGCCACCTGGCCATTTTGGG - Intergenic
905971786 1:42147027-42147049 GGCTGCCCCCTGGTGATGGCAGG - Intergenic
921207175 1:212858623-212858645 CGCTGCCGCCTCGGGAGTTCTGG + Exonic
923261575 1:232272778-232272800 GGGAGCCACCTGGCGATTACAGG + Intergenic
1063415248 10:5867985-5868007 AGATGCCGCCTGGCGTTTACAGG + Intronic
1063515937 10:6695237-6695259 GGCTGCCGCCTGGAGATCTTGGG - Intergenic
1067277469 10:44848121-44848143 GCCAGCCGACTGGAGATTTCTGG + Intergenic
1072466217 10:95664854-95664876 GGCTGCAGCCTGATGATGTCTGG + Intronic
1075483894 10:122804871-122804893 TGCTGCCGCCTGCTGAGTTCCGG + Intergenic
1076640141 10:131910112-131910134 CGCTGCCACCTGGCGAGTTATGG - Intronic
1076648431 10:131970464-131970486 GGCTGCAGGCTGGTGGTTTCTGG + Intronic
1076889605 10:133277150-133277172 GAGGGCCGCCTGGCGGTTTCAGG + Intergenic
1077229173 11:1450936-1450958 GGCTGCTGCTGGGCGCTTTCGGG - Intronic
1081735931 11:45404271-45404293 GGTTGACTCCTGGAGATTTCTGG - Intergenic
1086901425 11:92372105-92372127 TGCTGCCTCCTGCCCATTTCTGG + Intronic
1091383443 12:77683-77705 GGGAGCCGGCTGGAGATTTCTGG - Intronic
1095373442 12:41497634-41497656 GGCTGCCTCCTGGCTAATTGTGG - Intronic
1095853261 12:46832503-46832525 GGTTGCCGCCTGACGATTGGTGG - Intergenic
1117457247 14:55910872-55910894 GGCTCCTGCCAGGCTATTTCAGG + Intergenic
1128394581 15:67211136-67211158 GGCTGTAGCCTGCAGATTTCTGG + Intronic
1128658272 15:69478499-69478521 TGCTGCTGCCTGTCTATTTCAGG - Intergenic
1136021931 16:27445958-27445980 GGCTGCCCTCTGGTGATGTCAGG + Intronic
1141591697 16:85073496-85073518 GGCTGCCAGCTGGAGATTTGGGG + Intronic
1141633901 16:85303717-85303739 GGCCGCCGCCTCCCGAGTTCTGG + Intergenic
1147312545 17:39604105-39604127 GGGTGCCACCTGGCGATTTCCGG - Intronic
1149521282 17:57320101-57320123 GGCTGCTGCCTTGAGTTTTCTGG + Intronic
1150132656 17:62677592-62677614 GGCTGCAGACGGGTGATTTCTGG + Intronic
1150830242 17:68512406-68512428 GGCTGCGGCCAGGCCGTTTCCGG + Exonic
1151439899 17:74121613-74121635 GGCTGCTGGCTGGAGACTTCAGG + Intergenic
1152261968 17:79272176-79272198 GGCTGCTGCCTGTGTATTTCTGG - Intronic
1153667493 18:7379329-7379351 GGCTTCCACCTGGGGATTGCTGG - Intergenic
1161217049 19:3099770-3099792 GTCTGCCGACAGGCGCTTTCAGG + Intronic
1167402995 19:49285381-49285403 GGCTGCCGCATGGAGGTTGCTGG + Intergenic
1167790660 19:51677242-51677264 GGCTGCCTCTTGGCCATTTTGGG + Intergenic
1168148331 19:54431539-54431561 GGCTGCCGCTTAGTGAGTTCTGG + Intronic
928738748 2:34324202-34324224 GGCAGCCTGCTGCCGATTTCAGG - Intergenic
936070314 2:109365388-109365410 GGCTGCTGCTTGGGGATTTCTGG + Intronic
938012700 2:127841562-127841584 GGCTGCTGCCTGGGGACATCGGG + Intergenic
943102787 2:183508308-183508330 GACTGCCACCTGGCGTTTACAGG - Intergenic
1176281735 20:64317104-64317126 GGGAGCCGGCTGGAGATTTCTGG + Intergenic
1180258922 21:46652950-46652972 GGCTGCCTCCTGGACCTTTCAGG + Intronic
1183121287 22:35731987-35732009 GGCTCCCACCTGTCCATTTCAGG - Intergenic
1183619385 22:38963806-38963828 GGCTCCCACCTCACGATTTCTGG + Intronic
1183640273 22:39088418-39088440 GGCTCCCACCTCACGATTTCTGG + Intergenic
967254620 3:187577018-187577040 CGCTGGGGCCTGGAGATTTCTGG + Intergenic
968500501 4:947712-947734 GGCCGCTGCCTGGCGGTTACAGG - Exonic
975004572 4:69269677-69269699 ACCTGCCGCCTGGCAATTTGGGG + Intergenic
981081909 4:140644750-140644772 GGCTGCAGCCTGGAGAGTACAGG + Intronic
996164742 5:120210883-120210905 GATTGCCACCTGGCCATTTCGGG - Intergenic
999505125 5:152186552-152186574 GGGTGCCTCCTGGCAATTTTCGG + Intergenic
1001651062 5:173316777-173316799 AGCTGCGTCCTGGCGATTCCAGG - Exonic
1003879979 6:10471145-10471167 GCCTGCTGCCTGGGGATTTTGGG - Intergenic
1005225569 6:23638319-23638341 GTCTGCCACCTGGCTATTTTGGG - Intergenic
1006694708 6:35921064-35921086 CGCAGGCGCCTGGCGATTACCGG - Exonic
1011359832 6:86511433-86511455 GGCTGCTGCCTGGGGATTGGGGG + Intergenic
1012002772 6:93674753-93674775 GACTGCCACCTGGCCATTTTGGG + Intergenic
1014173520 6:118306164-118306186 GGCTGCCACCTGGCCATTTTGGG - Intronic
1018686211 6:166307044-166307066 GGCTGCCGGCTGGCGAGGGCAGG + Exonic
1023806237 7:43875012-43875034 GGCTGCCTGCTGTGGATTTCTGG - Intronic
1028599723 7:92589202-92589224 GGTTGCAGCCTGACAATTTCTGG - Intronic
1029005601 7:97206067-97206089 GGCTACCACCTGGCCATTTGGGG - Intergenic
1029699420 7:102236697-102236719 GGCTGCCTCCTGGCTAGTGCAGG - Intronic
1029713782 7:102314639-102314661 CGCTGCCGCCCGGGGATTCCAGG - Exonic
1032520083 7:132537221-132537243 GGCTGCTGCCTGGATATGTCTGG - Intronic
1034986850 7:155521544-155521566 GGCTGCCGCCTGGCGATTTCAGG - Intronic
1038875371 8:31542806-31542828 GGCTGACACCTGGGCATTTCAGG - Intergenic
1057503489 9:95614388-95614410 GGCTGCCACCTGTCCATTTCTGG + Intergenic
1062586889 9:137253537-137253559 GGCTGCCGCTGGGTCATTTCCGG + Intergenic
1062726827 9:138078884-138078906 GGCTGCATCCTGGGGTTTTCTGG + Intronic
1189553549 X:42118127-42118149 GCCTGCCGCCTGGCTAGTTTTGG + Intergenic
1194600350 X:95913197-95913219 AGCTGCCGCCTGGGGGTTCCTGG + Intergenic
1197881236 X:131169188-131169210 GGCTGCCACCTGGTAATTTGAGG + Intergenic
1197988799 X:132295245-132295267 GGCTGCTGCCTGGCCACTTTGGG - Intergenic
1198170262 X:134098343-134098365 GACTGCCGCCTGGCCACTTTGGG + Intergenic
1201885751 Y:18880197-18880219 GGCTGCCGCATGGCGCTTGCGGG + Intergenic