ID: 1034986926

View in Genome Browser
Species Human (GRCh38)
Location 7:155522072-155522094
Sequence CTGTGTGTGTGGATGCATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1547
Summary {0: 1, 1: 2, 2: 24, 3: 195, 4: 1325}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034986926_1034986932 2 Left 1034986926 7:155522072-155522094 CCCACATGCATCCACACACACAG 0: 1
1: 2
2: 24
3: 195
4: 1325
Right 1034986932 7:155522097-155522119 GCGGCACCACGTGGAGAGTCGGG No data
1034986926_1034986934 17 Left 1034986926 7:155522072-155522094 CCCACATGCATCCACACACACAG 0: 1
1: 2
2: 24
3: 195
4: 1325
Right 1034986934 7:155522112-155522134 GAGTCGGGCTGTGCTCACCCAGG 0: 1
1: 0
2: 1
3: 15
4: 265
1034986926_1034986931 1 Left 1034986926 7:155522072-155522094 CCCACATGCATCCACACACACAG 0: 1
1: 2
2: 24
3: 195
4: 1325
Right 1034986931 7:155522096-155522118 TGCGGCACCACGTGGAGAGTCGG 0: 1
1: 0
2: 0
3: 6
4: 65
1034986926_1034986930 -7 Left 1034986926 7:155522072-155522094 CCCACATGCATCCACACACACAG 0: 1
1: 2
2: 24
3: 195
4: 1325
Right 1034986930 7:155522088-155522110 CACACAGCTGCGGCACCACGTGG 0: 1
1: 0
2: 1
3: 6
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034986926 Original CRISPR CTGTGTGTGTGGATGCATGT GGG (reversed) Intronic
900032685 1:382218-382240 ATGTGTGTGTCTAGGCATGTGGG + Intergenic
900053442 1:611280-611302 ATGTGTGTGTCTACGCATGTGGG + Intergenic
900122035 1:1052515-1052537 GTGTGTGTGTGTGTGCATATGGG + Intronic
900150526 1:1177162-1177184 GTGTGTGTGTGCATGTCTGTAGG + Intronic
900293776 1:1938304-1938326 GTGTGTGAGTGCATGTATGTGGG - Intronic
900293791 1:1938455-1938477 CTGTGTGTGTGTGAGCCTGTGGG - Intronic
900414505 1:2528841-2528863 CTGTGTGGGTGGATGCGTGTGGG - Exonic
900489185 1:2938097-2938119 CTCTGTATGTGTGTGCATGTGGG - Intergenic
900566918 1:3337877-3337899 ATGTGTGTGTCCGTGCATGTGGG - Intronic
900593574 1:3470406-3470428 CAGTGTGTGTGCATGGGTGTGGG + Intronic
900646416 1:3710765-3710787 CCACGTGTGTGCATGCATGTGGG - Intronic
900734762 1:4291612-4291634 CTGTGCGTGTGTATGCCAGTGGG + Intergenic
900802240 1:4744612-4744634 GTGTGTGTGCATATGCATGTGGG - Intronic
900908608 1:5578070-5578092 CTCTGTGTGTGGGTGTGTGTGGG + Intergenic
900910208 1:5591977-5591999 ATGTGTGTGTGTATACATGTGGG - Intergenic
900952999 1:5868728-5868750 ATGTGTGGGTGCATGCATGTGGG - Intronic
900953003 1:5868768-5868790 TTGTGTGCGTGTGTGCATGTGGG - Intronic
900953014 1:5868897-5868919 ATGTGTGGGTGCATGCATGTGGG - Intronic
900953018 1:5868937-5868959 CATTGTGTGTGTGTGCATGTGGG - Intronic
900953029 1:5869070-5869092 ATGTGTGGGTGCATGCATGTGGG - Intronic
900953044 1:5869226-5869248 GTGTGTGTGTGTGTGCATGTGGG - Intronic
900978211 1:6030692-6030714 ATGTGTGTGTGTATGTGTGTAGG + Intronic
900978561 1:6033195-6033217 ATGTGCGTGTGTGTGCATGTGGG + Intronic
901804612 1:11730303-11730325 GTGTGTGTGTGCATGTGTGTAGG - Intergenic
901804619 1:11730365-11730387 GTGTGTGTGTGCATGTGTGTAGG - Intergenic
902272475 1:15314617-15314639 GTGGGTGTGAGGATGTATGTGGG + Intronic
902463599 1:16599498-16599520 GTGTGTGTGTGTATGTGTGTGGG - Intronic
902538370 1:17135055-17135077 GTGTGTGTGTATGTGCATGTGGG - Intergenic
903004986 1:20292565-20292587 ACGTGTTTGTGGGTGCATGTGGG + Intronic
903062816 1:20682128-20682150 GTATGTGTGTGCATGCATGCGGG - Intronic
903062820 1:20682186-20682208 TTGTGTGTGTGCACGCATGCGGG - Intronic
903228117 1:21905250-21905272 GTGTGTGTGTGGGTGTGTGTGGG - Intronic
903265146 1:22153729-22153751 ATGTGTGTGTGAATGTGTGTTGG + Intergenic
903325151 1:22564957-22564979 CTGTGTGTGTGCTTGTGTGTAGG - Intronic
903345034 1:22678454-22678476 ATGTGTGTGTGTATGTGTGTGGG - Intergenic
903659980 1:24970972-24970994 CTGTGTGTGTGAGTGTGTGTAGG + Intergenic
903659984 1:24971008-24971030 TTGTGTGTGTGCATGTGTGTGGG + Intergenic
904043205 1:27595898-27595920 GTGTGTGTGTGGAAGTGTGTGGG + Intronic
904123662 1:28220823-28220845 CTGTGTGCTTGGAGCCATGTTGG - Intronic
904259592 1:29280665-29280687 GTGTGTGTGTGTGTGTATGTGGG + Intronic
904272687 1:29360964-29360986 CTGTGTGTGTGTATGTGTGTGGG + Intergenic
904453808 1:30634558-30634580 GTGTGTGTGTGCATGCACATGGG + Intergenic
904453815 1:30634704-30634726 GTGTGTGTGTGCACGCATGTGGG + Intergenic
904497334 1:30894433-30894455 TTGAGTGTGTGGATGAGTGTGGG + Intronic
904687685 1:32272758-32272780 CTGTGTGTGTGGGGGTGTGTGGG + Intronic
904991683 1:34598357-34598379 GTGTGTGTGTGTATGTATTTTGG - Intergenic
905174355 1:36126484-36126506 CTGTGTGCGTGTGTGCATGTAGG + Intergenic
905174370 1:36126646-36126668 GTGTGTGTGTGCATGCGTGTAGG + Intergenic
905174452 1:36127021-36127043 GTGTGTGTGTGGCTGTGTGTGGG + Intergenic
905238886 1:36570046-36570068 GTGTGTCTGTGTATGCAGGTGGG - Intergenic
905246103 1:36614948-36614970 GTGTGTGTGTATATGTATGTAGG + Intergenic
905354424 1:37371555-37371577 ATGTGTGTGTGTGTGTATGTAGG - Intergenic
905742213 1:40381543-40381565 GTGTGTGTGTGTGTGCGTGTGGG + Intronic
905786181 1:40759614-40759636 ATATGTGTGTGTATGTATGTAGG + Intronic
906077633 1:43063686-43063708 GTGTGTGTGTGCGCGCATGTAGG + Intergenic
906583193 1:46953242-46953264 CTGTCTTTGTAGATGCATTTTGG - Intergenic
906601184 1:47130806-47130828 CTGTCTTTGTAGATGCATTTTGG + Intergenic
906662298 1:47591405-47591427 GTGTGTGTGTGTGTGCCTGTGGG + Intergenic
906693026 1:47805225-47805247 CAGTGTGTGTGGATGAATGTGGG - Intronic
906838236 1:49107633-49107655 CTGTGTGTATATATGCCTGTGGG + Intronic
906869760 1:49465204-49465226 GTGTGTGTGTGTGTGTATGTAGG - Intronic
907222049 1:52914354-52914376 CTGTGTGTGTGCATGCATGTTGG + Intronic
907387862 1:54137691-54137713 GTGTGTGTGTGTGTGCATGCGGG + Intronic
907553134 1:55321119-55321141 GTGTGTGTGTGAGTGTATGTTGG + Intergenic
907634510 1:56120041-56120063 GTGTGTGTGTGTGTGCATGAAGG - Intergenic
907805046 1:57810437-57810459 CTGTGTGTGTGTATTTGTGTGGG + Intronic
908384003 1:63623236-63623258 CTTTGTGTGTGGGTGCGAGTGGG + Exonic
908658777 1:66416198-66416220 GTGTGTGTGTTTGTGCATGTGGG + Intergenic
908934179 1:69354531-69354553 GTGTGTGTGTGTATGCATGTGGG - Intergenic
908972660 1:69856009-69856031 CTATGTGTGTCTCTGCATGTGGG + Intronic
909106474 1:71415902-71415924 GTGTGTATGTGGATGTGTGTGGG + Intronic
909506871 1:76401880-76401902 CTCTGTTTCTGGAAGCATGTTGG - Intronic
909919993 1:81369107-81369129 ATGTTTGTAGGGATGCATGTGGG + Intronic
909943429 1:81636293-81636315 GTATGTGTGTGTATGTATGTAGG + Intronic
909975499 1:82041999-82042021 CTGTGTGTGTGTATGTGTGTAGG + Intergenic
910129188 1:83883353-83883375 GTGTGTGTGTTTGTGCATGTGGG + Intronic
910373719 1:86546461-86546483 TGGTGTGTGTGTATGTATGTAGG - Intergenic
911035424 1:93540064-93540086 CCGTGTGTGTGTATGTGTGTGGG + Intronic
911139464 1:94483310-94483332 GTGTGTGTGTGTATGTGTGTCGG - Intronic
911317336 1:96370926-96370948 CTGGGAGTGGGGATGCCTGTGGG + Intergenic
911664509 1:100538629-100538651 CTGTGTGTGTGTGTGTGTGTTGG + Intronic
911714720 1:101118541-101118563 ATGTATGTGTGTATACATGTGGG - Intergenic
911876322 1:103167994-103168016 CTGTGTGTGTGTGTGCGGGTTGG + Intergenic
911987673 1:104650588-104650610 GTGTGTGTGTGTATGCATCTGGG + Intergenic
912448159 1:109752870-109752892 GTGGGTGGGTGGGTGCATGTGGG - Intronic
912489053 1:110051348-110051370 CTGGGTCTGTGGATGCCTTTGGG + Intronic
913333379 1:117685692-117685714 ATGTGTGTGTGTATGCTTGAAGG + Intergenic
913370116 1:118089345-118089367 GTGTGTGTGTGGTGGCAGGTAGG + Intronic
913385322 1:118252761-118252783 TGGTGTGTGTGGGTGCATGTGGG + Intergenic
913448361 1:118973763-118973785 GTGTGTGTGTGTATGTGTGTAGG - Intronic
913538464 1:119796519-119796541 ATGTGTGTGTGGCTGTATATTGG + Intronic
913690127 1:121271736-121271758 ATGTGTGTGTGCATGTGTGTTGG + Intronic
914147413 1:145008227-145008249 ATGTGTGTGTGCATGTGTGTTGG - Intronic
915047011 1:153026270-153026292 GTGTGTATGTGTATGCATGTGGG + Intergenic
915062416 1:153197164-153197186 GTGTGTGTGTGTGTGTATGTTGG + Intergenic
915293490 1:154902556-154902578 GTGTGTGTGTGCATGTGTGTGGG - Intergenic
915308287 1:154993603-154993625 CTGTGTCCGGGGCTGCATGTGGG - Exonic
915325086 1:155077774-155077796 GTGTGTGTCAGGATGCATGTGGG + Intergenic
915647867 1:157286775-157286797 GTGCGTGTGTGCATGCAGGTTGG - Intergenic
915662803 1:157417742-157417764 GTGTGTGTGTGCGTGCATGTTGG + Intergenic
915788879 1:158646110-158646132 CTGTGTGTGTATGTGTATGTTGG - Intronic
915943521 1:160134122-160134144 ATGTGTGTGTGTGTGTATGTGGG - Intronic
916738884 1:167631080-167631102 CTGTGTGTATGGAGGTATGCTGG + Intronic
917013085 1:170497153-170497175 GTGTGTGTGTGTGTGCATGTAGG - Intergenic
917049221 1:170900168-170900190 GTGTGTGTGTGTATCCATATGGG - Intergenic
917702214 1:177592769-177592791 GTGTGTGCGTGCATGCATGCAGG + Intergenic
918093359 1:181315974-181315996 GTGTGTGTGTGTGTGTATGTTGG + Intergenic
918205986 1:182309887-182309909 GTGTGGCTGTGGATACATGTGGG + Intergenic
918581179 1:186131755-186131777 CTGTGTGTGTAAATTTATGTAGG - Intronic
918651263 1:186966212-186966234 CTGTGTGTGTGGGTGGTTGGGGG + Intronic
918830990 1:189398308-189398330 CTGTGTCTGTTGGTGCATCTGGG + Intergenic
919342451 1:196329895-196329917 GTGTGTGTGTGTATTCATCTGGG + Intronic
919930092 1:202215474-202215496 TTCTGTGTGTGGAGGTATGTGGG - Intronic
920071671 1:203306793-203306815 GTGTGTGTGTGTGTGCGTGTTGG - Intronic
920112579 1:203597768-203597790 CTGTGTGTGGGGGTGGCTGTGGG - Intergenic
920284124 1:204867650-204867672 GTGTGTGTGTGTAAGCGTGTTGG - Intronic
920302085 1:204995342-204995364 GTGTGTGTGTGTATGTGTGTCGG + Intronic
920477449 1:206290217-206290239 ATGTGTGTGTGCATGTGTGTTGG + Intronic
920490993 1:206415286-206415308 CTGGATGTGTGTATGCAAGTCGG + Intronic
920498619 1:206472560-206472582 GTGTGTGTGTGTATGTGTGTAGG - Intronic
921055917 1:211542373-211542395 GTGTGTGTGTGTGTGCACGTGGG - Intergenic
921148457 1:212381038-212381060 GTATGTGTGTGTATACATGTGGG - Intronic
921309310 1:213827101-213827123 ATGTGTGACTGGATGGATGTGGG + Intergenic
921445377 1:215240415-215240437 GTGTGTGTGTGCATGTGTGTGGG + Intergenic
921708599 1:218351288-218351310 CTATGTGTGTGTTTGCATGTGGG + Intronic
922856847 1:228782914-228782936 GTGTGTGTGTGGGTGTGTGTGGG + Intergenic
922881890 1:228987232-228987254 CTGTGTGTGTGTATGCGTGTGGG - Intergenic
923109777 1:230881555-230881577 GGGAGTGTGTGGATGCATTTTGG - Intergenic
923199276 1:231695589-231695611 GTGTGTATGTGTGTGCATGTAGG + Intronic
923377946 1:233384655-233384677 GTATGTGTGTGCATGTATGTTGG + Exonic
923443872 1:234049396-234049418 CTGTGTGTGTGTGTGCACATTGG + Intronic
923622096 1:235587700-235587722 CTGTGTGTGAGGGTGTGTGTGGG + Intronic
923789807 1:237102355-237102377 ATGTGTGTGTGCCTGCATGCAGG - Intronic
923920504 1:238559247-238559269 GTGTGTGTGTGTGTGCGTGTGGG + Intergenic
924085495 1:240447251-240447273 CTGTGTGTGTTGGGGGATGTTGG + Intronic
924286978 1:242497476-242497498 GTGTGTGTATGGAGGCAGGTGGG + Intronic
924398319 1:243649343-243649365 GTGTGTGTGTGTGTGTATGTTGG + Intronic
1062831395 10:608275-608297 CTGTGTGTGTGTGTGTGTGTAGG - Intronic
1062984303 10:1753248-1753270 TTGTGTGTTTGGAGGCATGGGGG + Intergenic
1063073618 10:2692032-2692054 GTGTGCGTGTGTGTGCATGTGGG - Intergenic
1063257249 10:4341925-4341947 TTATGTGTGTACATGCATGTGGG - Intergenic
1063482380 10:6386910-6386932 CTGTGTATGTGCCTGTATGTGGG - Intergenic
1063589096 10:7378578-7378600 GTGTGTGTGTGTATGGCTGTGGG + Intronic
1063727810 10:8658109-8658131 TTGTGTGTGTGGAGGGGTGTGGG + Intergenic
1064227155 10:13497132-13497154 TTGTGTGTGTGTGTGCATGCGGG - Intronic
1065183329 10:23148450-23148472 CTGTGCGTGTGTGTGCATGTGGG + Intergenic
1065773480 10:29099140-29099162 GTGTGTGTGTGTGTGCAGGTAGG + Intergenic
1066122916 10:32308653-32308675 CAGTGTGTGAGGATTCCTGTGGG - Intronic
1066206098 10:33190796-33190818 GTGTGTGTGTGCATGTGTGTTGG + Intronic
1067215163 10:44295148-44295170 TGGTGCGTGTGTATGCATGTGGG - Intergenic
1067469422 10:46525101-46525123 CTGTGTCTGTGTTTGGATGTGGG - Intergenic
1067536784 10:47116571-47116593 ATGTGTGTGTGGATGTTTATGGG + Intergenic
1067583261 10:47458897-47458919 GTGTGTGTGTGTGTGCACGTAGG - Intergenic
1067758813 10:49027355-49027377 CTGAGTCTGTGGACACATGTTGG - Intronic
1068382178 10:56270191-56270213 GTGTGTGTGTGTGTGCATGTGGG + Intergenic
1068395316 10:56453955-56453977 ATGTGTGTGTGTATGTGTGTGGG - Intergenic
1068407593 10:56611000-56611022 TTGTGTGTGTGCATGTGTGTGGG - Intergenic
1068416053 10:56724170-56724192 TTGTGTATGTGTTTGCATGTAGG + Intergenic
1069177147 10:65305932-65305954 GTGTGTGTGTGTGTGCACGTAGG + Intergenic
1069261843 10:66408050-66408072 GTGTATGTGAGGATGCACGTAGG - Intronic
1069266616 10:66466299-66466321 GTGTGTGTGTGGGTGTAGGTGGG - Intronic
1069549650 10:69354131-69354153 CTGTGACCCTGGATGCATGTGGG - Intronic
1069713940 10:70508809-70508831 GTGTGTGTGTGCAGGCCTGTGGG + Intronic
1069713946 10:70508847-70508869 GTGTGTGTGTGCAGGCCTGTGGG + Intronic
1070196346 10:74160643-74160665 TTGTGTGCGTGCATGCAGGTAGG + Intronic
1070196350 10:74160667-74160689 GTGTGTGCGTGCATGCAGGTAGG + Intronic
1070375194 10:75823747-75823769 GTGTGTGTGTGTATGTAAGTAGG - Intronic
1070638567 10:78148975-78148997 GTGTGTGTGTGTGTGTATGTGGG + Intergenic
1070638570 10:78149010-78149032 GTGTGTGTGTGTGTGTATGTGGG + Intergenic
1070981232 10:80649857-80649879 ATGTGTGTGTGTATGAATGTAGG + Intergenic
1071058177 10:81535366-81535388 ATGTGTGTGTGTATGTGTGTGGG + Intergenic
1071121692 10:82286366-82286388 GTTTGTGTGTGGATATATGTAGG + Intronic
1071127486 10:82352184-82352206 GTGTGTTTGTGCATGTATGTGGG - Intronic
1071147938 10:82597178-82597200 ATGTGTGTATGTTTGCATGTGGG + Intronic
1071319001 10:84433424-84433446 GTGTGTGTGTGTATGTGTGTGGG - Intronic
1071394940 10:85213560-85213582 CTGAGTGTGTTGTTGCATCTAGG + Intergenic
1071433839 10:85628211-85628233 GTGTGTGAGTGTGTGCATGTTGG + Intronic
1071496469 10:86170666-86170688 GTGTGTGTGTGTATGTGTGTGGG - Intronic
1071832028 10:89381403-89381425 CTGTGTGTGGGGGTGTGTGTGGG - Intronic
1071935861 10:90529641-90529663 CTGTGTGTGTGTGTGTGTGTGGG + Intergenic
1072000586 10:91191814-91191836 CTGTCTGTGAGCATTCATGTTGG + Intronic
1072484109 10:95837990-95838012 CTGTGTGTGTGGGTGTGTGTGGG - Intronic
1072532006 10:96328430-96328452 GTGTATGTGTGGGTGCATGTAGG + Intronic
1072696440 10:97607230-97607252 CTGTGTGTCTGGCAGCAGGTGGG + Intronic
1072785974 10:98282546-98282568 CTGTGTGTGTACATGTGTGTTGG + Intergenic
1073080712 10:100858851-100858873 GTGGGTGTGTGGGTGAATGTTGG - Intergenic
1073467463 10:103702599-103702621 GTGTGTGTGTGTGTGCATGCTGG + Intronic
1073543283 10:104329032-104329054 GTGTGTGTGTGCATGCGTGCAGG - Intronic
1073588547 10:104734084-104734106 GTGTGTGAGTAGATGTATGTTGG + Intronic
1073611919 10:104952703-104952725 GTCTGTGTGTGCATGCATTTAGG - Intronic
1073621326 10:105051952-105051974 CTGTATGTCTGGTTGCATCTTGG + Intronic
1073725754 10:106228422-106228444 CTGGGTGTGGCGGTGCATGTCGG + Intergenic
1073858734 10:107710877-107710899 GTGTGTGTGTGTGTGTATGTAGG - Intergenic
1074236733 10:111592255-111592277 GTGTGTGTGTGCATGTATGTAGG + Intergenic
1074372748 10:112913473-112913495 ATGTGTGTGTGTGTGGATGTGGG + Intergenic
1074654042 10:115561669-115561691 CTGTGTGTGTGTGTGTGTGTGGG + Intronic
1074863800 10:117533284-117533306 GTGTGTGTGTGAATGTATTTGGG - Intergenic
1075082685 10:119394394-119394416 CTGTGTGTGGGCATGTGTGTGGG + Intronic
1075284859 10:121174707-121174729 GTGTGTGTGTGTGTGTATGTTGG - Intergenic
1075403910 10:122181220-122181242 ATGTGTCTGTGTGTGCATGTTGG + Intronic
1075805435 10:125185352-125185374 GTGTGTGTGTGTAAGCATATAGG - Intergenic
1075829501 10:125394113-125394135 GTGTGTGTGTGTGTGTATGTAGG + Intergenic
1076068678 10:127468889-127468911 GTGTGTGTGTTCATGCATGCAGG + Intergenic
1076138314 10:128060121-128060143 CTGTGTGAATGTGTGCATGTGGG - Intronic
1076480009 10:130778765-130778787 CTGTGTGGTTGGATGAAGGTGGG + Intergenic
1076480108 10:130779345-130779367 ACGTGTGTGTCCATGCATGTAGG - Intergenic
1076535849 10:131176583-131176605 CTGTGTGTGTGCATGTGTTTTGG - Intronic
1076600475 10:131654066-131654088 TTGTGTGTGTGTGTGTATGTGGG - Intergenic
1076672695 10:132131799-132131821 GTGTCTGTGTGGGTGCAGGTGGG + Intronic
1076933837 10:133554718-133554740 GTGTATGTGTGTATGCAGGTGGG + Intronic
1077004889 11:349903-349925 GTGTGTGTGTGGGTGTGTGTGGG - Intergenic
1077134742 11:992926-992948 CTGTGTGTGTGAGAGCATGCTGG + Intronic
1077205495 11:1340944-1340966 CTCTGTGTGTGTCTGGATGTGGG - Intergenic
1077340371 11:2023741-2023763 GTGTGTGTGTGGGTGCAGGGAGG + Intergenic
1077418007 11:2434337-2434359 GTGTGTGTGTGAATGTGTGTAGG + Intergenic
1077916557 11:6615413-6615435 GTGTTTGTGTGGATGGATGCAGG - Intronic
1078042953 11:7884974-7884996 GTGTGTGTGTGAATGCATGTGGG + Intergenic
1078065930 11:8079690-8079712 GTGTGTGTGTGCATGTGTGTAGG + Intronic
1078334872 11:10455507-10455529 CTGTGTGTGTGGATGGGGGTGGG + Intronic
1078381794 11:10848974-10848996 CTGTGTGTGGTGATGCATGCTGG - Intronic
1078448515 11:11423095-11423117 CTGTGTGTGAGTGTGCTTGTGGG - Intronic
1079051400 11:17163558-17163580 CTGTGTGTGGTGATGCACGCTGG - Intronic
1079383113 11:19956355-19956377 GTGTGTGTGTGTATGTGTGTCGG - Intronic
1079405194 11:20138786-20138808 GTGTGTGTATGCATGCATATGGG - Intergenic
1079801140 11:24870468-24870490 CTGTGTGTGTGTGTGTGTGTAGG - Intronic
1079821542 11:25137212-25137234 TTGTGTGTGTGTATACATGTAGG + Intergenic
1079928532 11:26527434-26527456 ATGTCTTTGTGGATTCATGTGGG + Intronic
1080111621 11:28574492-28574514 CTCTGTTTCTGGATGCATATGGG + Intergenic
1080544713 11:33304753-33304775 CTGTGTCTATGGATACTTGTAGG + Intronic
1080619429 11:33974664-33974686 CTGTGTGTGTGTGTGTGTGTTGG - Intergenic
1080885072 11:36360074-36360096 CTGTGTGTGTGTGTGTGTGTGGG - Intronic
1080953112 11:37059551-37059573 CGGTGTGTATGTGTGCATGTAGG - Intergenic
1080981617 11:37414126-37414148 GTGTGTGTGTGTAAGTATGTTGG + Intergenic
1081183077 11:40007875-40007897 CTGTGTGTGTGCCTGCACGTGGG - Intergenic
1081297717 11:41411836-41411858 CTGTAAGTGTGGGTGTATGTGGG + Intronic
1081437062 11:43038809-43038831 GTTTTTGTGTGGAAGCATGTTGG - Intergenic
1081475891 11:43430698-43430720 GTGTGTGTGTGCGTGTATGTAGG - Intronic
1082099342 11:48159100-48159122 GTGTGTGTGTGTGTGTATGTGGG + Intronic
1082662544 11:55930175-55930197 TTGTGTGTGTGCATGTGTGTAGG + Intergenic
1083256227 11:61497177-61497199 CTGTGTGTGTGGGTGTGTGTGGG + Intergenic
1083273164 11:61582079-61582101 GTGTGTGTGTGTGTGTATGTAGG - Intergenic
1083830230 11:65226899-65226921 GTGTGTGTGTGTAAGTATGTGGG - Intergenic
1084214772 11:67641314-67641336 CCGTGTGTCTGCGTGCATGTGGG - Intergenic
1084265229 11:68002175-68002197 GTGTGTGTGTGTATGCAAGCGGG - Intronic
1084481861 11:69426280-69426302 GGGTGCGCGTGGATGCATGTGGG + Intergenic
1084565336 11:69925271-69925293 GTGGATGTGTGGATGCATGGAGG + Intergenic
1084576667 11:69993080-69993102 GTGTGGGTTTGGCTGCATGTGGG - Intergenic
1084609180 11:70191334-70191356 GTGTGTGTGTGTGTGTATGTTGG + Intergenic
1084711082 11:70844096-70844118 GGGTGTGTGTGGATGGATGGAGG - Intronic
1084908690 11:72369763-72369785 CTGTGTGTGTGTATGTATGTGGG + Intronic
1085050485 11:73377575-73377597 GTGAGTGTGTGGATGCAGGTGGG - Intronic
1086120313 11:83298982-83299004 CTGTGTCTGTGTCTGCAGGTGGG - Intergenic
1086316437 11:85599289-85599311 ATGCGTGTGTGTATGTATGTGGG - Intronic
1086902905 11:92387581-92387603 GTGTCTGTGTGGCTGGATGTAGG + Intronic
1086956703 11:92941274-92941296 CTGTCTGTCTGGAAGCATTTTGG - Intergenic
1087401350 11:97670348-97670370 CTGTGTGTGTGCATGTATGTAGG - Intergenic
1087429919 11:98040577-98040599 GTGTGTGTGTGTGTGTATGTGGG - Intergenic
1087561871 11:99800801-99800823 CTGTGGGTGTTGTTTCATGTGGG + Intronic
1088184609 11:107151682-107151704 CTGTTTGTGTGTATGTATTTAGG + Intergenic
1088699853 11:112402350-112402372 TTGTGTGTGTGCATGCTTGTGGG - Intergenic
1088780442 11:113128939-113128961 GTGTGTGTGTGCATGCGTGCAGG + Intronic
1089047721 11:115517852-115517874 GTGTGTGTGTGCACACATGTGGG - Intergenic
1089637274 11:119823276-119823298 ACGTGTGTGTGTGTGCATGTTGG + Intergenic
1089892602 11:121896443-121896465 CTGTTTCTGTGGAAGCTTGTAGG + Intergenic
1090366406 11:126210510-126210532 GTGTGTGTGTGTATGTATGTTGG - Intronic
1090390347 11:126383737-126383759 CTCTGAGTGTGGATGCAGCTGGG + Intronic
1090415190 11:126535579-126535601 GTGTGTGTGTGTGTGCACGTGGG + Intronic
1090484776 11:127103225-127103247 GTGTGTGTGTGCACGCATATAGG - Intergenic
1090761927 11:129845287-129845309 GTGTGTGTGTGTATGCATGAAGG + Intronic
1090761932 11:129845357-129845379 GTGTGTGTGTGTATGCATGAAGG + Intronic
1091019645 11:132087879-132087901 CTGTGGATGTGGATGCATAGTGG + Intronic
1091196834 11:133738745-133738767 GTGTGTATGTGGGTGCATGTGGG + Intergenic
1091196952 11:133739268-133739290 TTGTGGGTGTGTGTGCATGTGGG + Intergenic
1091287267 11:134414550-134414572 GTGTGTGTGTGTGTTCATGTGGG - Intergenic
1091354513 11:134925447-134925469 ATGTGAGTGTGTATGAATGTGGG + Intergenic
1091354520 11:134925609-134925631 GTGTGTGTGTGAGTGAATGTGGG + Intergenic
1202823356 11_KI270721v1_random:78930-78952 GTGTGTGTGTGGGTGCAGGGAGG + Intergenic
1091683858 12:2547543-2547565 CTGTGTGTGTAAATGCGTGTGGG + Intronic
1091708677 12:2720927-2720949 CTGTGTGTGTGTGTCTATGTGGG - Intergenic
1092105905 12:5921605-5921627 GTGTGTGTGTGCATGGATGCTGG - Intronic
1092229341 12:6767993-6768015 CTGTGTCTGTGCATGGCTGTCGG + Intronic
1092595370 12:9998305-9998327 CTGTGCGTGGGGATGGTTGTCGG - Exonic
1093167366 12:15820030-15820052 CTGTGTGTATGCATGCATGAAGG - Intronic
1093259777 12:16921281-16921303 ATGTGTGTGTGTGTGTATGTTGG + Intergenic
1093381121 12:18494388-18494410 GTGTGTGTGTGGGTGGGTGTGGG + Intronic
1093897620 12:24592698-24592720 GTGTGTGTGTGTATGCACATTGG + Intergenic
1094130585 12:27070551-27070573 GTGTGTGTGTGCATACATGCTGG + Intergenic
1094212706 12:27909470-27909492 GTGTGCATGTGCATGCATGTTGG + Intergenic
1094272737 12:28635582-28635604 GTGTGTGTGTGAATGCACGTGGG + Intergenic
1094299228 12:28942822-28942844 GAGTGTGTGTGTGTGCATGTGGG + Intergenic
1094301313 12:28967699-28967721 GTGTGTGTGTGTTTGCATGGGGG - Intergenic
1094410804 12:30167170-30167192 GTGTGTGTGTGTATGTATGTAGG - Intergenic
1094489930 12:30953617-30953639 CTGAGTGTGTGTGTGCGTGTAGG + Intronic
1094561693 12:31560532-31560554 TTGTGTGTGTGTATGCAGGGAGG - Intronic
1095847015 12:46757443-46757465 GTGTGTGTGTGCATGCATGCTGG + Intergenic
1095976655 12:47944858-47944880 ATGTGCGTGTGTGTGCATGTGGG - Intergenic
1096749691 12:53751155-53751177 CTGTGCGTGCGGAGGCCTGTGGG - Intergenic
1097460988 12:59861646-59861668 GTGTGTGTGTGTGTGTATGTGGG - Intergenic
1097475654 12:60052624-60052646 GTGTGTGTGTGTGTGTATGTGGG - Intergenic
1097518311 12:60635744-60635766 GTGTGTATGTGAATACATGTGGG + Intergenic
1097565247 12:61261117-61261139 GTGTGTGTGTGTCTGCATGTAGG - Intergenic
1098027163 12:66215779-66215801 GTGTGTGTGTGTGTGCATGTTGG - Intronic
1098281326 12:68865607-68865629 GTGTGTGTGTGGGTGTGTGTGGG - Intronic
1098484296 12:71003051-71003073 GTGTGTGTGTGTATGTGTGTGGG - Intergenic
1098656510 12:73037607-73037629 ATGTGTGTGTGGGTTTATGTGGG - Intergenic
1098997417 12:77136684-77136706 CTGTATGTGAGGAAGCATGGTGG + Intergenic
1099147584 12:79066041-79066063 TTGTGTATGTTCATGCATGTGGG - Intronic
1099219068 12:79890894-79890916 GTGTGTGTGTGGGTGGGTGTGGG - Intronic
1099724036 12:86401266-86401288 GTGTGTGTGTGTGTGTATGTGGG + Intronic
1099750940 12:86771724-86771746 ATGTGTGTGTGTATGAATATTGG + Intronic
1100136958 12:91565378-91565400 CTGTGTGTGGGGGTGTGTGTGGG - Intergenic
1100175101 12:92021473-92021495 ATTTGTGTGTGTTTGCATGTGGG + Intronic
1100929525 12:99590247-99590269 GTGTGTGTGTGGGTGGGTGTGGG - Intronic
1101660678 12:106762837-106762859 CTGTGTGTGTGTGTGTGTGTGGG + Intronic
1101841986 12:108334333-108334355 CTGTGTGAATAAATGCATGTGGG - Intronic
1101915865 12:108895443-108895465 CGGTGTGTGTGCACGTATGTGGG + Intronic
1102572717 12:113836914-113836936 GTGTGTGTGTGTGTGTATGTGGG - Intronic
1102835289 12:116052068-116052090 GTGTGTGTGTGTATGTGTGTAGG - Intronic
1102866076 12:116375371-116375393 ATGTGTGGGAGTATGCATGTGGG + Intergenic
1102866078 12:116375421-116375443 ATGTGTGTGTGCATGTGTGTGGG + Intergenic
1103052564 12:117792986-117793008 TGGTGTGTGTGCGTGCATGTTGG - Intronic
1103052671 12:117794740-117794762 TTGGGTGTGTGTATGCATGTTGG - Intronic
1103165784 12:118769325-118769347 GTGTGTGTTGGGGTGCATGTGGG + Intergenic
1103231832 12:119337854-119337876 GTGTGTGTGTGTCTCCATGTTGG + Intronic
1103738337 12:123075035-123075057 ATTTGTGTGTGCGTGCATGTGGG + Intronic
1104151312 12:126086347-126086369 ATTTGTGTGTGTGTGCATGTGGG + Intergenic
1104242768 12:127006902-127006924 ATGTGTGTGTAGATGTTTGTAGG - Intergenic
1104308440 12:127632013-127632035 GTGTGTGTGTGTATTTATGTGGG + Intergenic
1104595939 12:130120035-130120057 CAGTGTGTGAAGATGCATGTGGG - Intergenic
1104655841 12:130573444-130573466 GTGCGTGCGTGGGTGCATGTGGG + Intronic
1104816323 12:131647992-131648014 GTGTGTGTGTGCGTGCATGGGGG - Intergenic
1104916188 12:132265888-132265910 CAGTGTGTGTTGGAGCATGTAGG + Intronic
1104916521 12:132267847-132267869 ATGCGTGTGTGTGTGCATGTGGG - Intronic
1104916523 12:132267874-132267896 GTGTGCGTGTGAGTGCATGTGGG - Intronic
1105405622 13:20129807-20129829 GTGTGTGTGTGAATGTGTGTGGG - Intergenic
1105532085 13:21229345-21229367 ATGTGTGTGAGTGTGCATGTAGG - Intergenic
1105532100 13:21229444-21229466 GTGTGTGTGAGTGTGCATGTGGG - Intergenic
1105543997 13:21338813-21338835 TTGTGTCTGTGGAGGCAGGTCGG + Intergenic
1106005638 13:25768059-25768081 CTGTGTGTGTGGTGGCGTGGGGG + Intronic
1106173126 13:27306332-27306354 GTGTGTGTGTGTACACATGTGGG + Intergenic
1106385464 13:29281435-29281457 GTGTGTGTGTGTGTGCATGCAGG + Intronic
1106560791 13:30844301-30844323 GTGTGTGTGTGGGTGTGTGTGGG + Intergenic
1106585635 13:31054184-31054206 CTGTGTGTGTGCGTGCACGGGGG - Intergenic
1106585665 13:31054353-31054375 CTGTGTGTGTGTGTGCATGGGGG - Intergenic
1106585799 13:31055306-31055328 CTGTGTGTGTGCATGCACAGGGG - Intergenic
1106602896 13:31202261-31202283 CCGTGTCTGTATATGCATGTGGG - Intronic
1106912375 13:34476632-34476654 CTGTGTGTGTGGGAGGGTGTAGG - Intergenic
1107022097 13:35762655-35762677 GTGTGTGTATGTATGAATGTAGG - Intergenic
1107022184 13:35763740-35763762 GTGTGTGTGTGTAGGCGTGTAGG - Intergenic
1107394677 13:40003170-40003192 CTGTGTGTGTGTCTGTGTGTGGG - Intergenic
1107820426 13:44280997-44281019 GGGTGTGTGTGTGTGCATGTTGG - Intergenic
1107820429 13:44281019-44281041 GTGTGTGTGTGTGTGCATGTTGG - Intergenic
1107944728 13:45407613-45407635 ATGTGTCTTTGGATCCATGTTGG - Intronic
1108004361 13:45932334-45932356 GTGTGTGTGTGCATGTGTGTGGG - Intergenic
1108163049 13:47662796-47662818 ATGTGTGTATGTATGTATGTAGG - Intergenic
1108187768 13:47905551-47905573 GTGTGTGTGTGTATGTATGTAGG - Intergenic
1108789651 13:53952210-53952232 GTGTGTGTTTGCATGTATGTTGG - Intergenic
1108835495 13:54541704-54541726 GTGTGTGTGTGTATGCATGTTGG + Intergenic
1109209629 13:59519945-59519967 GTGTGTGTGTGTATGTGTGTGGG - Intergenic
1109219608 13:59627947-59627969 CTGTGTGTGTGTTTGGTTGTGGG + Intergenic
1109266485 13:60206543-60206565 GTGTGTGTGAGGGTGAATGTGGG - Intergenic
1109266709 13:60208774-60208796 ATGTGTGTGTGGGTGTGTGTGGG - Intergenic
1109504233 13:63278627-63278649 TTGTGTGTGTGTATATATGTAGG - Intergenic
1109613901 13:64805441-64805463 GTGTGTGTGTGTCTGCATGTGGG + Intergenic
1109654129 13:65367258-65367280 ATGTGTGTGTGTGTGTATGTGGG + Intergenic
1109771894 13:66985776-66985798 ATGTGTGTGTGTTTGCATGTTGG + Intronic
1109898766 13:68733433-68733455 GTGTGTGTGTGTTTGCTTGTGGG - Intergenic
1110364534 13:74667060-74667082 GTGTGTGTGTGTATACATATAGG + Intergenic
1110394061 13:75009630-75009652 GGGTGTATGTGCATGCATGTGGG - Intergenic
1110457526 13:75706592-75706614 CTGTGTGTGTGCATGGGTGTAGG - Intronic
1110462242 13:75757826-75757848 GTGTGTGTGTGTGTGTATGTTGG + Intronic
1110700069 13:78536606-78536628 GTGTGTGTGTGTGTGTATGTTGG - Intergenic
1110811937 13:79820940-79820962 CTATGTGTGTCTCTGCATGTGGG + Intergenic
1110814065 13:79841912-79841934 CTATGTGTGTCTCTGCATGTGGG - Intergenic
1110849814 13:80232319-80232341 GTGTGTGTGTGTGTGTATGTAGG + Intergenic
1110875938 13:80510555-80510577 GTGTGTGTGTGTGTACATGTGGG + Intergenic
1110921538 13:81093525-81093547 GTGTGTGTGTGTATGTATGTTGG + Intergenic
1111155547 13:84318788-84318810 GTGTGTGTGTGGGTGTGTGTGGG + Intergenic
1111160196 13:84384466-84384488 CAGTGTGTTTGGATGCTGGTGGG - Intergenic
1111289632 13:86148114-86148136 GTGTGTGTGTGGGTGTGTGTGGG - Intergenic
1111356410 13:87109636-87109658 CTGTGTTTGTGTGTGTATGTGGG + Intergenic
1112312668 13:98333428-98333450 GTGTGTGTGTGTGTACATGTGGG - Intronic
1112401225 13:99080250-99080272 CTGTGTGTGTGTAGGCACTTAGG - Intronic
1112407479 13:99134146-99134168 GTGTGTTTGTAGATGCATGAAGG + Intergenic
1112447414 13:99477327-99477349 GTGTGTGTATGTGTGCATGTGGG + Intergenic
1112841881 13:103589953-103589975 GTGTGTGTGTGTGTGTATGTGGG - Intergenic
1112983794 13:105421059-105421081 CTGTGTGTGTTGGTGGAGGTGGG + Intergenic
1113076777 13:106474858-106474880 GTGTGTGTGTGTGTGCACGTGGG + Intergenic
1113078830 13:106494843-106494865 CTGTGTGTATGGAGGTCTGTGGG - Intronic
1113108713 13:106799015-106799037 CTTTCTGTGTGTATGCATCTCGG - Intergenic
1113597315 13:111542766-111542788 GTGTGTGTGTGTATGGATGAAGG + Intergenic
1113612118 13:111654481-111654503 GTCTGTGTGTGGAAGAATGTAGG - Intronic
1113766590 13:112885068-112885090 GTGTGTGTGTGTATGCGTGTAGG - Exonic
1113780167 13:112972261-112972283 ATGGGTGGGTGGATGAATGTAGG + Intronic
1113865659 13:113521118-113521140 CTGTGTGTGTGTGTGTAGGTAGG + Intronic
1113870585 13:113557375-113557397 AGGTGTGTGTGCATGTATGTAGG + Intergenic
1113964016 13:114142123-114142145 CTGTGTGCATGTGTGCATGTGGG - Intergenic
1113964024 13:114142237-114142259 CTATGTGTATGTGTGCATGTGGG - Intergenic
1113964026 13:114142281-114142303 GTGTGTGTCTGTGTGCATGTGGG - Intergenic
1114073482 14:19133198-19133220 CTGTGTGGCTAGATGCATTTCGG + Intergenic
1114088783 14:19266785-19266807 CTGTGTGGCTAGATGCATTTCGG - Intergenic
1114155236 14:20095226-20095248 GTGTGTGTGTTCATGCTTGTGGG - Intergenic
1114669946 14:24405074-24405096 GTGTGTGTGTGTATGTGTGTTGG + Intronic
1114825672 14:26075283-26075305 GTGTGTGTGTGTGTGTATGTAGG - Intergenic
1114959537 14:27867794-27867816 CTCTTTGTGTGGTTGCATGATGG - Intergenic
1115153530 14:30313004-30313026 GTGTGTGTGTGCATGCATGTTGG - Intergenic
1115258039 14:31423149-31423171 CTGTCTGAGTGGATGCAGTTAGG + Intronic
1115310777 14:31975740-31975762 CTCTTTCTGTGGATGCAAGTCGG - Intergenic
1115841296 14:37473531-37473553 CTGTGTGTGTGAATGGGAGTAGG + Intronic
1116361037 14:43998476-43998498 GTGTGTGTGTGTGTGTATGTAGG + Intergenic
1116552019 14:46252764-46252786 GTGTGTGTGTGTATACATATAGG + Intergenic
1116572259 14:46533290-46533312 CTATGTGTGTCTTTGCATGTGGG + Intergenic
1116628734 14:47301284-47301306 GTGTGTGTGTGGGTGGGTGTGGG - Intronic
1117091988 14:52260883-52260905 TTGTGTGTTTGTTTGCATGTTGG - Intergenic
1117557197 14:56897811-56897833 ATGTGTGTGTGTATGGTTGTTGG + Intergenic
1117582800 14:57169780-57169802 ATGTGTGTGTGGATGGGTGGGGG - Intergenic
1117950261 14:61075821-61075843 GTGTGTGTGTGTATGTATTTGGG + Intronic
1118002626 14:61537820-61537842 AAGTGTGTGTGTATGCATGTGGG + Intronic
1118111428 14:62724916-62724938 CTGTGTGTTTGCATGCTGGTGGG - Intronic
1118277218 14:64395865-64395887 TTGTGTGTGTGGATTAATGATGG + Intronic
1118330456 14:64811348-64811370 GTGCGTGTGTGCATGCACGTGGG - Intronic
1118562159 14:67097556-67097578 GTGTGTGTGTGCAGGTATGTAGG - Intronic
1118629913 14:67693532-67693554 GTGTGTATGTGCATGCGTGTGGG - Intronic
1118658952 14:67986042-67986064 CTGTGTGTGTATGTGCATTTGGG + Intronic
1118810330 14:69268510-69268532 GTGTGTGTGTGGAGGCAGGAGGG - Intronic
1118850815 14:69581905-69581927 GTGTGTGTGTGCGTGCATGTTGG - Intergenic
1118853816 14:69605934-69605956 GTGTGTGTGTGTGTGTATGTGGG + Intergenic
1118971400 14:70641576-70641598 GTGTGTGTGTGCGTGCGTGTAGG - Intergenic
1119601490 14:75979915-75979937 CTGTGTGTGTGGAAGGAAGAGGG - Intronic
1119615789 14:76098245-76098267 CTGTGTGTGTGTGTGCGTCTGGG + Intergenic
1119635874 14:76273067-76273089 CTCTGTGTGTGCATGTGTGTGGG - Intergenic
1119926076 14:78495155-78495177 GTGTGTGTGAAGTTGCATGTTGG + Intronic
1120158516 14:81120251-81120273 CTCTGTGTGTGGAAGCTTATTGG - Intronic
1120486851 14:85124904-85124926 GTGTGTGTGTGAATGTGTGTGGG - Intergenic
1120651863 14:87143869-87143891 GTGTGTGTGTGTGTGCATGAGGG - Intergenic
1120708282 14:87767332-87767354 GTGTGTGTGTGTTTGCATGTAGG - Intergenic
1120898471 14:89555861-89555883 GTGTGTGTGTGTGTGTATGTGGG + Intronic
1120996007 14:90419290-90419312 ATGTGTGTGTGTGTGCGTGTGGG - Intergenic
1121656319 14:95598878-95598900 GTGTGTGTGTGTATGTTTGTGGG + Intergenic
1121733532 14:96202738-96202760 GTGTGTGGGTGGATGGATGGAGG + Intergenic
1121799349 14:96760716-96760738 CTGGGTGGGTGGATGAATGATGG + Intergenic
1122122685 14:99562870-99562892 CTGTGTGTGTGTGTGCATATGGG - Intronic
1122141446 14:99665325-99665347 CTGTGTGTCTGGATTCTTCTTGG + Intronic
1122842296 14:104472359-104472381 CTGTGTGTGTGGCTGTGTGCAGG - Intergenic
1123054648 14:105563478-105563500 GTGGGTGTGTGGATGTGTGTGGG + Intergenic
1202836400 14_GL000009v2_random:80356-80378 CTGTGTGTGTTTACACATGTGGG + Intergenic
1123500054 15:20873354-20873376 GTGTGTGTGTGTGTGCATTTGGG + Intergenic
1123557302 15:21447054-21447076 GTGTGTGTGTGTGTGCATTTGGG + Intergenic
1123593527 15:21884305-21884327 GTGTGTGTGTGTGTGCATTTGGG + Intergenic
1124237774 15:28004478-28004500 CTGTGTGTGTGTCTGTGTGTGGG - Intronic
1124250890 15:28106055-28106077 ATGTGTGTGTGCATGTGTGTGGG + Intergenic
1124342987 15:28901926-28901948 GTGTGTGTGTGTGTGTATGTTGG + Intronic
1124483724 15:30098584-30098606 GTGTGTGTGTGTATGTATATGGG + Intergenic
1124701329 15:31915269-31915291 GCGTGTGTGTGCATGCATGTGGG + Intergenic
1124759852 15:32439992-32440014 GTGTGTGTGTGTATGTATATGGG - Intergenic
1125285197 15:38085257-38085279 CTGTGTGTGTGGGTGGGTGTGGG - Intergenic
1125476417 15:40050859-40050881 TAGTGTGTGTGGATGTGTGTAGG + Intergenic
1125726059 15:41868681-41868703 CTGTGTGAGTGGACTCAGGTGGG - Intronic
1125806901 15:42501238-42501260 ATGTGTGTGTGTATGTATGGAGG - Intronic
1125848214 15:42878482-42878504 GTGTGTGTGTGTATACATATCGG - Intronic
1126233966 15:46360673-46360695 CTATGTGTGTGGGTGTGTGTTGG + Intergenic
1126243818 15:46478742-46478764 GTGTGTGCATGCATGCATGTAGG + Intergenic
1126338312 15:47611142-47611164 GTGTGTGTGTGTGTGTATGTAGG - Intronic
1126897168 15:53271577-53271599 GTGTGTGTGTGTGTGTATGTTGG + Intergenic
1127373021 15:58357808-58357830 GTGTGTGTGTGTGTGCATGCAGG - Intronic
1127498804 15:59537134-59537156 GTGTGTGTGTGTGTGTATGTGGG + Intergenic
1128222274 15:65977764-65977786 GTGTGTGTGTGTATGCATGTAGG + Intronic
1128356683 15:66932875-66932897 CCGTGTGTGTGAATGCATGTGGG - Intergenic
1128451730 15:67809842-67809864 TTCTGTGCGTGCATGCATGTGGG - Intergenic
1128556200 15:68633508-68633530 GTGTGTGTGTGTGTGTATGTTGG - Intronic
1128585261 15:68843879-68843901 GTGTGTGTGTGTATGTGTGTGGG - Intronic
1129196726 15:73972945-73972967 GTGTGTGTGTGAATGCATTTGGG + Intergenic
1129226470 15:74173369-74173391 ATGTGTGTTTGCATGGATGTGGG - Intergenic
1129295423 15:74597502-74597524 GTGTGTGTGTGTATGTGTGTGGG - Exonic
1129460140 15:75696438-75696460 TTGTGTGTGCGCAAGCATGTGGG + Intronic
1129661372 15:77554808-77554830 CAGTGTGTGAGGGAGCATGTTGG + Intergenic
1129749226 15:78048966-78048988 CTGTGTGCTTTGATGCATATGGG - Intronic
1129934906 15:79439378-79439400 GTGTGTGTGTGGGTGTGTGTGGG + Intronic
1130501578 15:84503294-84503316 GTGTGTGAGTGTGTGCATGTGGG + Intergenic
1130542803 15:84833977-84833999 GTGTGTGTGTGTTTGCATGTGGG + Intronic
1130710606 15:86277324-86277346 GTGTGTGTGTGTGTGTATGTTGG + Intronic
1130749756 15:86698478-86698500 CTGTGTATGGGGGTGCAGGTGGG - Intronic
1130843839 15:87725983-87726005 CTGTGTGGGTGGGTGCAGGTGGG - Intergenic
1130850097 15:87784503-87784525 ATGTGTGTGTGTTTGTATGTTGG - Intergenic
1130980305 15:88807772-88807794 GTGTGTGTGTGTGTGCATGCTGG + Intronic
1131148061 15:90028669-90028691 CTCTGTGCGTGAATGCATGGAGG + Intronic
1131325017 15:91434522-91434544 GTGTGTGTGTGTGTGCATATGGG + Intergenic
1131619413 15:94051365-94051387 GTGTGTGTGTGTATGTATTTGGG - Intergenic
1131621923 15:94077687-94077709 TTGTGTGTGTGAGTGCATGAGGG - Intergenic
1131826915 15:96329746-96329768 CTGGGTGTGTGGCAGGATGTTGG + Intronic
1132023025 15:98381155-98381177 GTGTGTGTGTGTATGTGTGTTGG + Intergenic
1132188943 15:99831838-99831860 CTATGTGTGTCTCTGCATGTGGG + Intergenic
1202965648 15_KI270727v1_random:174227-174249 GTGTGTGTGTGTGTGCATTTGGG + Intergenic
1132668540 16:1093389-1093411 GTGTGTGTGTGGGTGGGTGTGGG - Intronic
1133039220 16:3051201-3051223 GTGTGTGTGTGTATGTGTGTGGG + Intronic
1133487635 16:6235584-6235606 GTGTGTGTGTGTATACATGATGG + Intronic
1133577982 16:7112664-7112686 CTGTGTGTGTGTGTGGGTGTGGG + Intronic
1134416865 16:14051358-14051380 CTGTGTGTTTGTATGCCTATAGG - Intergenic
1134598880 16:15517853-15517875 GTGTGTGTGTGGATGTGTGTGGG + Intronic
1135548107 16:23379104-23379126 CTGGGTGTGTGGGTGGATGATGG - Intronic
1135686245 16:24500419-24500441 CTGTGTCTGTGTGTGCATGCAGG + Intergenic
1135742157 16:24985175-24985197 GTGTGTGTGGGGTTGCATTTAGG - Intronic
1135856079 16:26011729-26011751 GTGTGTGTGTGCATGTGTGTAGG + Intronic
1135933145 16:26756711-26756733 ATGTGTGGGTGGATGAATGATGG + Intergenic
1136618988 16:31415516-31415538 CTGGGTGTGTGGATGGAGGTGGG - Intronic
1137322370 16:47398089-47398111 CTGTGTGTGTGGTCAAATGTGGG - Intronic
1138560195 16:57796735-57796757 GTGTGTGTGTGCATGCATATAGG - Intronic
1138585284 16:57965214-57965236 GTGTGTGTATATATGCATGTTGG - Intronic
1138918542 16:61498341-61498363 TTGTGTGTGTGCATGCATATGGG - Intergenic
1138957874 16:61992954-61992976 TTGTGTGTGTGTATGGAGGTGGG + Intronic
1138959535 16:62012010-62012032 GTGTGTATGTGCATGCAGGTGGG + Intronic
1139373934 16:66485170-66485192 CAGTGTGTGTATGTGCATGTGGG - Intronic
1139453939 16:67056512-67056534 GTGTGTGTGTGTATGTGTGTAGG + Intronic
1139837211 16:69848772-69848794 GTGTGTTTGTGTGTGCATGTAGG + Intronic
1139968779 16:70761005-70761027 GTGTGTGTGTGTGTGCATGGGGG + Intronic
1140036662 16:71376478-71376500 GGATGTATGTGGATGCATGTGGG - Intronic
1140046691 16:71444239-71444261 GTGTGTGTGTCTATGTATGTGGG + Intergenic
1140110757 16:72002633-72002655 GTGTGTGTGTGTGTACATGTAGG + Intergenic
1140177519 16:72677809-72677831 GTGTGTGTGTGGATTCTTTTGGG - Intergenic
1140722940 16:77787863-77787885 CTGTGTATGTGCATGCATGTTGG + Intergenic
1140962541 16:79930427-79930449 GTGTGTGTGTGTGTGCGTGTGGG + Intergenic
1141243302 16:82283295-82283317 GTGTGTGTGTGCATGTGTGTTGG + Intergenic
1141618066 16:85221382-85221404 TGGTATGTGTGTATGCATGTGGG - Intergenic
1141861943 16:86723328-86723350 TTGTGTGTGTGCATGCGTGCAGG + Intergenic
1141909849 16:87051219-87051241 GTGTGTGTGTACATGTATGTTGG + Intergenic
1141926449 16:87173449-87173471 GTGTGTGTGTGTGTGCATGTGGG - Intronic
1141928858 16:87187020-87187042 ATGTGTGTGTGCATGTGTGTGGG + Intronic
1141940228 16:87271093-87271115 GTGTGTGTGTGTGTGTATGTGGG - Intronic
1142018160 16:87763170-87763192 ATGTGTGGGTGGGTACATGTGGG - Intronic
1142039835 16:87885861-87885883 CTTTCTGTGTGGATGCATCATGG + Exonic
1142227040 16:88882554-88882576 CTGTGTGTGGGCATGGCTGTGGG + Intronic
1142259116 16:89034234-89034256 ATGTGTGTGTGAATGCGTGCGGG - Intergenic
1142259123 16:89034296-89034318 GTGTGTGTGTGAGTGCGTGTGGG - Intergenic
1142289937 16:89189254-89189276 CTGTGTGTGGGCATGTGTGTGGG - Intronic
1142410622 16:89914450-89914472 CTGTGTGTGTGCCTGTGTGTGGG + Intronic
1142626640 17:1196581-1196603 CTGTGTGTGTGGCTGCTCTTTGG - Intronic
1142759281 17:2033972-2033994 CTGAGTGTGTGTATGGTTGTGGG - Intronic
1143508431 17:7382338-7382360 GTGTGTGTGTGGCAGCATGTGGG + Intronic
1144201809 17:12948713-12948735 GTGTGTGTGTGTATGTGTGTTGG - Intronic
1144212192 17:13025054-13025076 CTGTGTGTGTGTATGTGTGTGGG + Intergenic
1144341110 17:14310894-14310916 GTGTGTGGGTGGATGGGTGTGGG + Intronic
1144437958 17:15258325-15258347 CTGTGTGTTTGGATGCAGACAGG - Intronic
1144460442 17:15454363-15454385 CTGTGTGTATTGCTGCCTGTTGG - Intronic
1144543156 17:16165825-16165847 GGGTGTGTGTGGATGTGTGTTGG - Intronic
1144721769 17:17476113-17476135 CTGTATGTGTGGTTGCAGGCAGG - Intergenic
1144922212 17:18773496-18773518 TTGTGTGTGTGTATGTAGGTGGG + Intronic
1145301302 17:21640493-21640515 GGGTGTGTGTGGATGTGTGTTGG + Intergenic
1145686565 17:26674533-26674555 CTGTGTGTGTCTCTGCACGTGGG + Intergenic
1145769171 17:27479923-27479945 GGGTGTGTGTGAATGTATGTAGG + Intronic
1145977974 17:28995328-28995350 CTGTGTGTGTGCATGTATGTGGG + Intronic
1146341971 17:32027469-32027491 CTGTGTGTGTGCTTGTGTGTGGG + Intronic
1146404880 17:32528461-32528483 GTGTGTGTGTGTATGTGTGTCGG + Intronic
1146492888 17:33294568-33294590 CTGTGTGGATGTATGTATGTGGG - Intronic
1146494721 17:33311448-33311470 GTGTGTGTGTAGATGTGTGTAGG + Intronic
1147222375 17:38944223-38944245 GTGTGTGTGTGTATGCTTCTTGG + Intronic
1147311030 17:39596373-39596395 CTGTGTGTATGTGTGTATGTGGG + Intergenic
1147442019 17:40453207-40453229 GTGTGTGGGTGCGTGCATGTGGG - Intronic
1147585503 17:41651907-41651929 GTGTGTGTGTGCATGTGTGTTGG - Intergenic
1147585510 17:41651976-41651998 TTGTGTGTGTGCATGTGTGTTGG - Intergenic
1148083495 17:44980378-44980400 GTGTGTGTATGCATGCTTGTAGG + Intergenic
1148345972 17:46903961-46903983 ATGTGTGTGTGGGTGGATGGTGG + Intergenic
1148520162 17:48266131-48266153 GTGTGTGTGTGGGTGTGTGTAGG - Intronic
1148682076 17:49479944-49479966 CTGTGTGTGTTTATGTGTGTTGG - Intergenic
1148686103 17:49502093-49502115 CTGTGTGTGTACAGGCCTGTGGG - Exonic
1149013504 17:51882444-51882466 TTGTGTGTGTGTATGGGTGTTGG + Intronic
1149066466 17:52486291-52486313 GTGTGTGTGTGCATGCATACTGG + Intergenic
1149684177 17:58526052-58526074 CTGTGAGAGTGTATGTATGTGGG - Intronic
1151177948 17:72304149-72304171 GTATGTGTGTGTGTGCATGTGGG + Intergenic
1151387825 17:73766017-73766039 GTGCGTGTGTGCATGGATGTAGG + Intergenic
1151412304 17:73939248-73939270 CTGTGTGTGTGTGTGTGTGTAGG - Intergenic
1151534113 17:74728232-74728254 CTGTATATGAGGATACATGTTGG + Intronic
1152028767 17:77828564-77828586 GTGTGTATGTATATGCATGTGGG + Intergenic
1152158841 17:78654355-78654377 GTGTGTATGTGTATGTATGTGGG - Intergenic
1152575481 17:81138764-81138786 ATGGGTGTGTGCGTGCATGTGGG - Intronic
1152947256 17:83204967-83204989 ATGTGTGTGTCTACGCATGTGGG - Intergenic
1153180982 18:2432723-2432745 GTGTGTGTGTGCATGTGTGTAGG - Intergenic
1153579605 18:6558987-6559009 ATGTGTGTGGGTATGAATGTGGG + Intronic
1153580257 18:6565906-6565928 GTGTGAGTATGCATGCATGTGGG + Intronic
1153738596 18:8099100-8099122 CTGTGTGTGTGTGTGCAGGCAGG - Intronic
1153993845 18:10422903-10422925 CTGTGCCTGTGGAGTCATGTGGG + Intergenic
1153998088 18:10459305-10459327 GTGTGTGTGTGCACGCTTGTGGG - Intronic
1154018349 18:10639664-10639686 CTGTGTGTGTGTGGACATGTTGG - Intergenic
1154062703 18:11078035-11078057 GTGTGTGTGTGGGTGTGTGTGGG - Intronic
1154333059 18:13445568-13445590 ATGTGTGTGTGTATGCGTGAGGG + Intronic
1154437188 18:14355486-14355508 GTGTGTGTGTGTCTGCGTGTAGG + Intergenic
1154957158 18:21270071-21270093 CTGTGTATGTACATGCATTTAGG + Intronic
1155416964 18:25608931-25608953 CTTTTTGTGTGTATGCATGTGGG - Intergenic
1155533319 18:26789995-26790017 CTTTGTGTGAGGAGGCATGAAGG + Intergenic
1155689275 18:28597995-28598017 GTGTGTGTGTGTATGCATGTAGG + Intergenic
1156534278 18:37847773-37847795 GTGTGTGTGTGCACGCATGCAGG - Intergenic
1157019157 18:43758218-43758240 CTGTGTGTTGGGGTGCAGGTGGG + Intergenic
1157300488 18:46475330-46475352 GTGTGTGTGTACATGAATGTGGG - Intergenic
1157625214 18:49045237-49045259 GTGTGGCTGTGGATGCATGTGGG - Intronic
1157700990 18:49761557-49761579 ATGTGTTTGGGGGTGCATGTGGG - Intergenic
1158038500 18:53064587-53064609 ATATCTGTGTGCATGCATGTTGG + Intronic
1158542728 18:58371465-58371487 CTGTGTGTGTGCTGGCGTGTGGG - Intronic
1158810505 18:61028341-61028363 GTGTGTGTGTGGGTGTGTGTGGG - Intergenic
1158981641 18:62767734-62767756 ATGTGTGTTTGGAGGCATGGGGG + Intronic
1159181491 18:64912411-64912433 GTGTGTGTTTGTATGCAGGTGGG + Intergenic
1159198218 18:65146212-65146234 CTGTGTGTGTGTATTCTTGCAGG - Intergenic
1159228271 18:65569798-65569820 GTGTGTGTGTGTATGTGTGTAGG + Intergenic
1159520919 18:69522223-69522245 GTGTGTGTGTGTATGTGTGTGGG - Intronic
1159554660 18:69932780-69932802 CAGTGTATGTGTGTGCATGTGGG - Intronic
1160159224 18:76458836-76458858 TTGTGTGTGTGCATGCCTGTAGG + Intronic
1160278390 18:77461754-77461776 GTGTGTGTGTGTGTGCATATAGG + Intergenic
1160395653 18:78570452-78570474 CTGTGTGTGTGTGCACATGTGGG - Intergenic
1160450607 18:78963113-78963135 ATGTGTGTGAGCATGCGTGTGGG - Intergenic
1160566464 18:79789290-79789312 ATGAGTGCGTGCATGCATGTGGG - Intergenic
1160567262 18:79794608-79794630 ATGTGTGCCTGGATGAATGTGGG + Intergenic
1160603595 18:80033292-80033314 CTGTGTGTGTGTGTGTGTGTGGG - Intronic
1160686038 19:437020-437042 GTGTGTGTGTGCATGTGTGTGGG - Intronic
1160952214 19:1673302-1673324 ATGTTTGTGTGTGTGCATGTGGG + Intergenic
1160977805 19:1802322-1802344 ATGGGTGGGTGGATGGATGTGGG - Intronic
1161038915 19:2099711-2099733 CTGTGAGTGTGGCTCCAAGTCGG - Intergenic
1161090362 19:2357152-2357174 ATGGGTGTGTGGATGGATGTTGG - Intergenic
1161120730 19:2524806-2524828 ATGGGTGTGTGCATGCGTGTTGG + Intronic
1161226516 19:3149070-3149092 GTGTGTGGGTGTGTGCATGTGGG - Intronic
1161933406 19:7356119-7356141 ATGTGTGTGTGTATGTGTGTTGG - Intronic
1161974472 19:7600555-7600577 GTGTGTGGGTGGATGGATGGGGG - Intronic
1162016791 19:7850590-7850612 GCGTGTGTGTGTATGCATGCGGG - Intronic
1162468448 19:10857252-10857274 GTGTGTGTGTGTATGTGTGTGGG + Intronic
1162530406 19:11232773-11232795 CTGTGTAGGTATATGCATGTGGG + Intronic
1162530418 19:11232854-11232876 CTGTGTATGTATATGCATGGGGG + Intronic
1162777558 19:12989167-12989189 TTGTGTGTGTGGATGAAGGCTGG + Intergenic
1162777623 19:12989569-12989591 TTGTGTGTGTGGATGAAGGATGG + Intergenic
1162788840 19:13052777-13052799 CTGTGTGTGTGGACGGGTGCAGG - Intronic
1162943994 19:14031563-14031585 GTGTGTGTGTGTATGGTTGTTGG + Intergenic
1164380328 19:27731003-27731025 CTGTGTGTGTGTTTGTGTGTGGG - Intergenic
1164675862 19:30100985-30101007 GTGTGTCTGTGGATGCTTCTTGG - Intergenic
1164686666 19:30170753-30170775 GTATGTGTGTGTGTGCATGTAGG + Intergenic
1164745645 19:30610754-30610776 GTGTGTGTGTGGAGGCGGGTGGG + Intronic
1164827623 19:31296133-31296155 GTGTGTGTGTGATTGTATGTGGG + Intronic
1164850198 19:31476904-31476926 GTGTGTGTGTGTATACATGATGG - Intergenic
1164882638 19:31747246-31747268 GTGTGTGTGTAGATATATGTAGG + Intergenic
1164882647 19:31747558-31747580 GTGTGTGTGTAGATATATGTAGG + Intergenic
1165076032 19:33280380-33280402 ATGTGTGTGTGTATGTGTGTTGG - Intergenic
1165744605 19:38223269-38223291 TTGTGTCTTTGGATGCATGAGGG - Intronic
1166256954 19:41613524-41613546 CTGTGTGTGTGTGTGGGTGTGGG - Intronic
1166333110 19:42090055-42090077 GTGTGTGCGTGCGTGCATGTGGG + Exonic
1166699961 19:44876628-44876650 CTCTGTGTGTGCCTGGATGTGGG - Intronic
1167072605 19:47229645-47229667 CTGTGTGTGTGTGTGTGTGTTGG - Intronic
1167445517 19:49534958-49534980 CTGTGTGTGTGGCAGGGTGTGGG - Intronic
1167524107 19:49973000-49973022 CTGTGAGTGTGGCTGGATGGGGG - Intergenic
1168475668 19:56673424-56673446 CTGTGTGTGTGGATGGGAGGAGG + Intergenic
1202636239 1_KI270706v1_random:47009-47031 CTGTGTGTGTTTACACATGTGGG - Intergenic
1202679256 1_KI270711v1_random:36937-36959 GTGTGTGTGTGGGTGGGTGTGGG - Intergenic
924991865 2:319353-319375 ATGTGTGTGTGGGTGTGTGTGGG + Intergenic
925126614 2:1461603-1461625 GTGAGTGTGTGCATGCCTGTGGG - Intronic
925308278 2:2865299-2865321 CTGTCTGTCTGGAGTCATGTGGG + Intergenic
925513463 2:4653311-4653333 GTGTGTGTGTGTATGTGTGTTGG + Intergenic
925515781 2:4679372-4679394 TTGTGTGTGTGTATGGGTGTGGG - Intergenic
925536527 2:4924103-4924125 CTATGTGAGTGTATGAATGTAGG + Intergenic
925536539 2:4924297-4924319 CTGTGTGAGTGTATGTAGGTAGG + Intergenic
925802060 2:7611114-7611136 CTGTGTGTGGGCATGCATGTGGG + Intergenic
925825858 2:7847954-7847976 GTGTGTGTGTGTGTGTATGTTGG + Intergenic
925999304 2:9317373-9317395 GTGTGTGTGTGGATGTGAGTTGG - Intronic
926146691 2:10400758-10400780 GTGTGTGTATGTGTGCATGTGGG - Intronic
926220570 2:10933161-10933183 ATGTGTGTGTGTGTGCATGGAGG + Intergenic
926293316 2:11548383-11548405 ATGTGTATGTGTATGTATGTGGG - Intronic
926705260 2:15833100-15833122 ATGTGTGTGTTTATGTATGTGGG + Intergenic
927041598 2:19236164-19236186 GTATGTGTGTGTATGTATGTGGG - Intergenic
927299272 2:21492240-21492262 GTGTGTGTGTGCATGCATAATGG - Intergenic
927339019 2:21959609-21959631 GTGTGTGTGTGTATGTATTTTGG + Intergenic
927689201 2:25195727-25195749 GTGTGTGTGTGTGTGCATGGTGG - Intergenic
927818958 2:26245270-26245292 GTGTGTGTGTGGGTGTGTGTGGG + Intronic
927845789 2:26472148-26472170 ATGTGTGTGTGCATGTATGTGGG - Intronic
928168585 2:28988795-28988817 CTGTGCCTGTGGAGGCATGCGGG - Intronic
928171301 2:29005189-29005211 GTGTGTGTGTGCATGTGTGTGGG + Intronic
928193780 2:29197722-29197744 CTGTGTGTGTGTGTGAATGTGGG - Intronic
928389923 2:30901425-30901447 GTGTGTGTGTGTATACATATAGG - Intergenic
928774445 2:34742476-34742498 TTGTATGTGTGTGTGCATGTAGG + Intergenic
928815263 2:35286709-35286731 GTGTGCGTGTGTATGTATGTAGG - Intergenic
928859285 2:35836500-35836522 TTGTGTGTGTGTGTGTATGTGGG - Intergenic
928937674 2:36696734-36696756 GTGTGTGTGTGTATGTGTGTGGG + Exonic
929259236 2:39845962-39845984 GTGTGTGTGTGTATGTATGTGGG + Intergenic
929299535 2:40287606-40287628 GTGTGTGTGTGTGTGCATGCAGG + Intronic
929778255 2:44941906-44941928 GTGTGTGTGTGGATGTGTGTGGG + Exonic
929949161 2:46393202-46393224 CTGTGAGTGTGCATGTATGTTGG - Intergenic
930971568 2:57401271-57401293 TTGTCTTTGTGTATGCATGTAGG + Intergenic
931062565 2:58547536-58547558 CTGTATGTCTGGATGCATTTGGG + Intergenic
931296804 2:60935400-60935422 CTGGGTGTGGTGATGCATGTCGG - Intergenic
931370899 2:61661611-61661633 CTAAATGTGTGGATGCGTGTAGG + Intergenic
931463621 2:62468557-62468579 GTGTGTATGTGGGTGCATGTGGG + Intergenic
931586361 2:63833968-63833990 GTGTGTGTGTGTGTGTATGTTGG - Intergenic
931694794 2:64863699-64863721 GGGTGTGTGTGTGTGCATGTGGG - Intergenic
931809505 2:65841212-65841234 GTGTGTGTGTGGGTGTGTGTGGG - Intergenic
931937523 2:67215023-67215045 ATGTGTGTGTGGAGGGATATGGG - Intergenic
932969978 2:76528794-76528816 CTGTGTGTATGGGTGGATGCAGG - Intergenic
932974976 2:76589036-76589058 GTGTGTGTGTGTGTGTATGTGGG + Intergenic
933060509 2:77731216-77731238 AAGTGTGTGTTTATGCATGTGGG + Intergenic
933104104 2:78300348-78300370 GTGTGTGTGTGTATGTGTGTTGG - Intergenic
933308558 2:80632275-80632297 CTGTGTGTGTGTGTGTGTGTTGG - Intronic
933440676 2:82309663-82309685 CTGTGTGTGTGTTTGTGTGTTGG - Intergenic
933517030 2:83317444-83317466 ATGTGTGTGTGTGTGTATGTAGG + Intergenic
933800912 2:85959686-85959708 GTGTGTGTTTGGGTGCAAGTGGG - Intergenic
933972628 2:87482442-87482464 GTGTGTGTGTGGGTGTGTGTGGG - Intergenic
934101836 2:88660599-88660621 ATGTATGTGTGTATGCAGGTGGG + Intergenic
934538975 2:95159284-95159306 CTGTGCGTGTGGATCCACGTGGG - Exonic
934578790 2:95421416-95421438 ATATGTATGTGCATGCATGTGGG - Intergenic
934600657 2:95655287-95655309 ATATGTATGTGCATGCATGTGGG + Intergenic
934896952 2:98127570-98127592 CTGTGTGTGTGTGTGTGTGTGGG + Intronic
935205707 2:100895097-100895119 GTGTGTGTGTGTACGCATGATGG - Intronic
935345247 2:102101963-102101985 GCGTGTGTGTGGGTGCGTGTGGG + Intronic
935534131 2:104273528-104273550 GTATGTGTGTGAATGCGTGTAGG - Intergenic
935610634 2:105020945-105020967 GTGTGTGTGTGTGTGTATGTGGG + Intergenic
935715602 2:105936514-105936536 CTGTGTAGATGTATGCATGTTGG - Intergenic
935715617 2:105936650-105936672 GTGTGTGTATGGATGTTTGTTGG - Intergenic
935734529 2:106096194-106096216 GTGTGTGTGTGTATGTATGTGGG + Intronic
935841623 2:107118244-107118266 TTATGTGTGTGTATGTATGTGGG + Intergenic
936278048 2:111117519-111117541 CTGTGTGTGCGGGTGCTTGGTGG + Intronic
936485634 2:112923132-112923154 CTGTGTCTGTGCCTTCATGTTGG - Intergenic
936534025 2:113297411-113297433 ATATGTATGTGCATGCATGTGGG + Intergenic
936792992 2:116171925-116171947 GTGTGTGTGTATGTGCATGTGGG + Intergenic
936937397 2:117851531-117851553 GTGTGTGTGTGCATGTGTGTTGG + Intergenic
937239271 2:120449931-120449953 GTGTGTGTGTGTGTGTATGTAGG + Intergenic
937503777 2:122513366-122513388 GTGTGTATGTGGATGTGTGTAGG + Intergenic
937581328 2:123492414-123492436 GTGTGTGTGTGCATGTATGTGGG + Intergenic
937727283 2:125182158-125182180 CAATGTGTGTGTATGCATGTGGG - Intergenic
938140183 2:128788949-128788971 GTGCGTGTGTGTCTGCATGTGGG + Intergenic
938605825 2:132891601-132891623 CTGTGTGTGCATATGCATATGGG + Intronic
938870322 2:135469230-135469252 GTGTGTGTCTGCATGCATGTTGG - Intronic
939070666 2:137537469-137537491 CTGAGTTTGTGAATGCCTGTAGG + Intronic
939202915 2:139061821-139061843 CTATGTGTGTGGGTGCATATGGG - Intergenic
939218986 2:139278099-139278121 TTGTGTGTGTGTGTGTATGTGGG + Intergenic
939734136 2:145822615-145822637 CTGTGTGTGTGTGTGTGTGTAGG - Intergenic
939853993 2:147334761-147334783 CTGTGTGTGTGAGAGTATGTGGG + Intergenic
940001354 2:148969451-148969473 GTGTGTGTGTGTATGTGTGTGGG + Intronic
940115563 2:150204561-150204583 CTGTGTGTGTGGGTGGCAGTAGG - Intergenic
940193397 2:151066248-151066270 GTGTGTGTATGCATGCATGTGGG - Intergenic
940205455 2:151197071-151197093 GTGTGTGTGTGTATGTGTGTTGG - Intergenic
940216149 2:151305499-151305521 CTGGGCATGTAGATGCATGTTGG - Intergenic
940415922 2:153419651-153419673 ATGTGTGTGTGCATGTATTTAGG - Intergenic
940558879 2:155268158-155268180 CTGTGTGTGTGTGTGTGTGTTGG + Intergenic
940571455 2:155440698-155440720 CTGTTTGTTTTGATACATGTGGG + Intergenic
940670121 2:156657184-156657206 GTGTGTGTGTGGTTGGAGGTGGG + Intergenic
941352109 2:164449726-164449748 TTGTGTGTGTGTATTCAGGTAGG - Intergenic
941427762 2:165369654-165369676 GTGTGTGTGTGGAGGCGGGTGGG - Intronic
941905628 2:170714953-170714975 GTGTGTGTGTGTGTGTATGTTGG + Intergenic
942048255 2:172113909-172113931 CTGTGTGTGTGACAGCCTGTGGG + Intergenic
942061497 2:172232241-172232263 GTGTGTGTGTGTGTGCATGCTGG + Intergenic
942501780 2:176598691-176598713 GTGAGTGTGTGTGTGCATGTGGG - Intergenic
942795809 2:179817789-179817811 CTGTGTGTGTGCATGCATGTTGG + Intronic
942986426 2:182148268-182148290 CTGTGTGTGTGGAGGGGGGTGGG + Intronic
943664522 2:190594967-190594989 TTGTATGTGTGGATGCATATAGG - Intergenic
943745657 2:191460355-191460377 GTGTGTGTGTGGAGGGATGGTGG - Intergenic
943829895 2:192447267-192447289 GTGTGTGTGTGTGTGTATGTTGG + Intergenic
944168458 2:196748821-196748843 GTGTGTGTGTTGATGATTGTGGG - Intronic
944863747 2:203840465-203840487 GTGTGTGTGTTGATGCATGAGGG + Intergenic
945024593 2:205607821-205607843 GTGTGTGTGTGTATGGGTGTTGG - Intronic
945072329 2:206004339-206004361 CTGTGTGTTTGCAGGCAGGTGGG - Exonic
945503824 2:210613111-210613133 GTGTGTATGTGTGTGCATGTGGG + Intronic
945633487 2:212316267-212316289 GTGTGTGTGTACATGCATGTGGG - Intronic
945660782 2:212682743-212682765 TTGTGTCTGTGGATGCATACCGG - Intergenic
946007436 2:216537753-216537775 GTGTGTGTGTGCATACATGCAGG - Intronic
946165326 2:217860052-217860074 CTGTGTCTGTGGAAGCATTTTGG - Intronic
946449457 2:219767351-219767373 CTGTGTGTGTGCATGTGTGTGGG + Intergenic
947027131 2:225748823-225748845 GTCTGTGTGTGCATACATGTTGG - Intergenic
947726944 2:232406985-232407007 CTGTGTGTGTGTGTGTGTGTAGG - Intronic
947812990 2:233015938-233015960 GTGTGTGTGTGTGTGCGTGTAGG + Intergenic
948256184 2:236569693-236569715 GTGTGTGTGTGTCTGCCTGTGGG + Exonic
948275386 2:236704291-236704313 CTGTGTGCTTGGACGCAAGTTGG + Intergenic
948297805 2:236875937-236875959 CTGTGTGTCTGGAAGCACGTTGG - Intergenic
948326866 2:237129774-237129796 CTGTGTGTGTGAGTACATGTGGG + Intergenic
948430350 2:237914496-237914518 GTGTGTGTGCGCATGCATGTGGG + Intergenic
948534117 2:238633316-238633338 TTGTGGGTGTGCATGCATGAAGG + Intergenic
948585705 2:239018350-239018372 ATGTGTGTGTGTAAGCATGTGGG + Intergenic
948596774 2:239084432-239084454 GTGTGAGTGTGTCTGCATGTGGG - Intronic
949050627 2:241895659-241895681 CTGTGTGGGTGGATGGAGGGGGG + Intronic
949053550 2:241911239-241911261 GTGTGTGTGTGGGTGTGTGTGGG - Intergenic
1168738818 20:169981-170003 TTGTTTGTGTGTGTGCATGTAGG - Intergenic
1169198625 20:3696957-3696979 CTGTGTGTGTGGCAGGAGGTGGG - Intronic
1169258092 20:4114026-4114048 TTGTGTGTGTGGCTGTATGTTGG + Intergenic
1169269642 20:4189173-4189195 GTGTGTGTGTGTATGTAGGTAGG - Intergenic
1169308357 20:4514431-4514453 CTGTGAGTGTGTGTGCATGTAGG + Intergenic
1169723163 20:8700876-8700898 CAGTGGGTGAGGATGGATGTGGG + Intronic
1169757831 20:9062369-9062391 GTGTGTGTGTGTTTGTATGTGGG + Intergenic
1170540391 20:17381781-17381803 ATATGTGTGTGTATGCTTGTGGG - Intronic
1170981390 20:21217469-21217491 CTGTTTGTGTGGGTGCATGCTGG + Intronic
1171030383 20:21671140-21671162 GTGGGAGTGTGTATGCATGTGGG - Intergenic
1171093851 20:22312492-22312514 GTGTGTGTGTGTGTGTATGTGGG - Intergenic
1171098660 20:22359608-22359630 GTGTGTGTGTGCATGTATGGTGG - Intergenic
1171104862 20:22422929-22422951 GTGTGTGTGTGCTTGTATGTAGG - Intergenic
1171163345 20:22948900-22948922 GTGTGTGTGTGTGTGCGTGTAGG - Intergenic
1171249043 20:23634880-23634902 CTGTGTGTGTGTGTGCATGTGGG - Intronic
1171262847 20:23748466-23748488 CTGTGGCTGTGGCTGCATGCAGG + Intronic
1171271974 20:23824670-23824692 TTGTGTCTGTGGCTGCATGCAGG + Intronic
1171320868 20:24242885-24242907 GTGTGTGTGTGTGTGCATGAGGG - Intergenic
1171323918 20:24273872-24273894 ATGTGTGTGTGTGTGCATGTGGG - Intergenic
1171444475 20:25194343-25194365 TTGTCTTTGTGCATGCATGTGGG - Intergenic
1171558964 20:26104335-26104357 GGGTGTGTGTGGATGTGTGTTGG - Intergenic
1172368252 20:34365985-34366007 CTGTGTGTGTGGCTGGGTGGAGG + Intronic
1172413216 20:34742029-34742051 CTGTGTCTGTGGCTGCAGTTGGG - Exonic
1172773533 20:37394914-37394936 GCGTGTGTGTGTGTGCATGTGGG + Intronic
1172780850 20:37436274-37436296 ATGGGTGGGTGGATGCATGACGG - Intergenic
1172854252 20:37989267-37989289 CTCTGTGTGAGTATGCATGTTGG - Intronic
1172870971 20:38135394-38135416 GTGTGTGTGTGTATACATTTAGG - Intronic
1173093929 20:40005570-40005592 ATGTGTGTGTGGGTGAGTGTAGG + Intergenic
1173164770 20:40679847-40679869 ATGTTTGTGTGCATGTATGTGGG + Intergenic
1173316864 20:41952440-41952462 GTGTGTCTGTGTATGCGTGTGGG + Intergenic
1173527540 20:43744450-43744472 GTGTGTGTGTGTATGCATGCCGG + Intergenic
1173547404 20:43909452-43909474 GTGTGTGTGTGTATGTATGTAGG + Intergenic
1173551315 20:43934810-43934832 GTGTGTGTGTGTGTGTATGTGGG + Intronic
1173706330 20:45112942-45112964 CTGTGTGTATGTATCTATGTGGG - Intronic
1173845379 20:46185120-46185142 GTGTGTGTGTGTATGCGTGTGGG - Intronic
1173850945 20:46217417-46217439 GTGTGTGTGTGAATGTATCTGGG - Intronic
1173888318 20:46481016-46481038 CTGTGTGTGTGGTTGGGGGTAGG + Intergenic
1174091230 20:48049866-48049888 GTGTGTGTGTGTGTGTATGTGGG + Intergenic
1174164897 20:48577631-48577653 CTGCGTGTGTGCATACATGGTGG + Intergenic
1174308778 20:49634295-49634317 GTGTGTGTGTGTATGTGTGTGGG - Exonic
1174390078 20:50213633-50213655 TTGTGTGTGTGCATGCAAGAGGG + Intergenic
1174579378 20:51560718-51560740 GTGTGTGTGTGTGTACATGTGGG - Intronic
1174657807 20:52186237-52186259 CTGTGTGTGTAGGTGTTTGTGGG + Intronic
1174738366 20:52986922-52986944 TTGTGTGTGTGTGTGTATGTAGG + Intronic
1174976102 20:55336899-55336921 GTGTGTGTGTGTGTGCATGCGGG - Intergenic
1175779220 20:61671756-61671778 GTGGGTGTGTGGATGGATGATGG + Intronic
1175914740 20:62420343-62420365 GTGTGTGTGTGTGTGCCTGTGGG - Intronic
1175931569 20:62496161-62496183 CTGGGTGTGTGGACACAGGTGGG + Intergenic
1175951349 20:62584984-62585006 GGGTGTGTGTGGGTGCATGAAGG - Intergenic
1176028454 20:62998372-62998394 TGGTGTGTATGCATGCATGTGGG - Intergenic
1176028464 20:62998459-62998481 GGGTGTGTGTGCATGCATGTGGG - Intergenic
1176028479 20:62998556-62998578 TGGTGTGTGTGCATGCATGGGGG - Intergenic
1176176891 20:63732289-63732311 GTGTGTGTGTGCATGTGTGTGGG + Intronic
1176430556 21:6573023-6573045 GTGTGTGTGTGTATGAGTGTGGG + Intergenic
1176514981 21:7777332-7777354 GTGTGTGTGTGTATGCTTATGGG + Intergenic
1176652055 21:9558296-9558318 GGGTGTGTGTGGATGTGTGTTGG + Intergenic
1176837846 21:13810292-13810314 GTGTGTGTGTGAAGGGATGTTGG + Intergenic
1176839860 21:13830157-13830179 GTGTGTGTGTGTCTGCATGTAGG - Intergenic
1176940286 21:14915634-14915656 CTGTGTGTGTGGATGGGGGTGGG + Intergenic
1177412710 21:20750911-20750933 GTGTGTGTGTGTGTGTATGTAGG - Intergenic
1177484079 21:21732408-21732430 GTGTGTGTGTGTATGAATTTAGG - Intergenic
1177499891 21:21940200-21940222 GTGTGTGTGTGTATGCATGTTGG + Intergenic
1177694010 21:24548786-24548808 CTGTGTGTGTGTGTGCATCTTGG + Intergenic
1177750753 21:25280694-25280716 GTGTGTGTGTGTGTGCATGTGGG - Intergenic
1177787557 21:25688289-25688311 ATGTGTGTGTGCGTGCGTGTGGG - Intronic
1177887751 21:26766321-26766343 ATGTGTGTGTGTATGTGTGTGGG - Intergenic
1178575729 21:33788270-33788292 GTGTGTGTGTGGAAGGAGGTGGG - Intronic
1178649036 21:34407391-34407413 GTGTGTGTGTGTATGCTTATGGG + Intronic
1179085558 21:38214396-38214418 GTGTGGGTGTGTGTGCATGTGGG - Intronic
1179270783 21:39849465-39849487 GTGTGTGTGTGTATGTGTGTGGG + Intergenic
1179497364 21:41781118-41781140 CTGTGTGTGTTGAAGCATAAAGG + Intergenic
1179705950 21:43180485-43180507 GTGTGTGTGTGTATGAGTGTGGG + Intergenic
1179731280 21:43369026-43369048 ATGTGTGTGTGCATGTGTGTGGG + Intergenic
1179921775 21:44511318-44511340 GTGTGTGTATGCATGCATGCAGG - Intronic
1179982653 21:44904367-44904389 TTGTGTGTGTGCATATATGTGGG - Intronic
1180491924 22:15855551-15855573 CTGTGTGGCTAGATGCATTTCGG + Intergenic
1180847555 22:18992294-18992316 CTGTGTGTGGGCCTGCGTGTGGG - Intergenic
1181762865 22:25069940-25069962 GTGTGTGTGTTTATGCATGAAGG - Intronic
1181768779 22:25111215-25111237 GTGTGTGTGTGCGTGTATGTCGG - Intronic
1181876961 22:25947104-25947126 GTGTGTGTGTGAATGCTTGTAGG - Intronic
1182078417 22:27511188-27511210 GTGTATGTGTGCATGGATGTGGG + Intergenic
1182211240 22:28679410-28679432 GAGTGTGTGTGGATGTGTGTGGG - Intronic
1182741329 22:32570144-32570166 CAGTGTGTGTGGAGGGAGGTTGG - Intronic
1182829742 22:33295348-33295370 ATGTGTGTGTACATGCGTGTGGG + Intronic
1182878481 22:33712674-33712696 GTGTGTGTGTGTCTGCATGTGGG + Intronic
1182948818 22:34352001-34352023 TTGTGTGTGTGCATGTGTGTTGG + Intergenic
1183055313 22:35301440-35301462 CTGTTTGGGTGAAGGCATGTCGG - Intronic
1183089541 22:35512005-35512027 GTGTGTGTGTGTGTACATGTAGG + Intergenic
1183246661 22:36699150-36699172 GTGTGTATGTGGATACAGGTAGG - Intronic
1183614845 22:38937623-38937645 ATGTGGGTGTGTGTGCATGTGGG + Intergenic
1183718150 22:39546408-39546430 CTGTGTGTGTGTGCACATGTGGG + Intergenic
1183964615 22:41434341-41434363 CTGTGTGTGTGGATGGGAGGAGG + Exonic
1184491709 22:44813561-44813583 GTGTGTGTGTAGTTGTATGTAGG - Intronic
1184491727 22:44813772-44813794 ATGTGTGTGTAGGTGTATGTAGG - Intronic
1184707684 22:46225566-46225588 ATGTGTGTGAGCATGCATGTGGG - Intronic
1184727472 22:46355337-46355359 CTGTGTGTGTGTGTGCTGGTAGG + Intronic
1184895500 22:47404276-47404298 CTGTCTGTGTGTCTGCATTTAGG + Intergenic
1184990628 22:48167034-48167056 CTGTGTGTGTGCATGTATGAAGG - Intergenic
1185047742 22:48537435-48537457 CTGTGTGCCAGGAGGCATGTGGG + Intronic
1185107387 22:48881652-48881674 TGGTGTGTGTGTCTGCATGTGGG - Intergenic
1185146414 22:49139442-49139464 GTGTGTGTGTGTGTGCGTGTGGG + Intergenic
1185265671 22:49901604-49901626 TTGTGTGTGTGCATGCGTGGTGG + Exonic
949122360 3:402021-402043 ATGCGTGTGTGGATGCAAATTGG - Intronic
949315182 3:2746021-2746043 GTGTGTGTGTGGGTGTGTGTGGG - Intronic
949407452 3:3729467-3729489 CTGTGTGTGTGTATGTGTGTGGG - Intronic
949726473 3:7052550-7052572 CTGTGTGTGTATATGGAGGTGGG - Intronic
949791516 3:7797301-7797323 GTGTGTGTGTGTATGTGTGTTGG + Intergenic
950463958 3:13142338-13142360 CTGTGTCTGAGCATGCATCTGGG - Intergenic
950479204 3:13234305-13234327 CTGTGTCTGTGTGTGCCTGTGGG + Intergenic
950591902 3:13942500-13942522 ATGTGTGTGTGTGTGTATGTAGG - Intronic
950845706 3:16013939-16013961 TTTTGTGTGTGTGTGCATGTGGG + Intergenic
951168788 3:19513488-19513510 GTGTGTGTGTGCATGCAGGATGG + Intronic
951295753 3:20932588-20932610 GTGTGTGTGTGTTTGCATTTTGG - Intergenic
951400351 3:22225501-22225523 CCGTTAGTATGGATGCATGTGGG + Intronic
952037355 3:29218828-29218850 GTGTGTGTGTGTGTGCGTGTAGG - Intergenic
952841967 3:37654179-37654201 GTGTGTGTGTGGAGGCAGGAGGG - Intronic
952973916 3:38677656-38677678 TTGTGTGTGTGTGTGCCTGTGGG - Intergenic
953070497 3:39515000-39515022 GTGTGTGTGTGTGTGTATGTTGG + Exonic
953131809 3:40146692-40146714 TTGTGTGTGTGTATTCATGCAGG - Intronic
953169267 3:40492759-40492781 ATGTGTGTGTGTGTGTATGTGGG + Intergenic
953412876 3:42700006-42700028 CTGTGTGTGTGTGTGTGTGTTGG + Intronic
953412884 3:42700080-42700102 CTGTGTGTGTGTGTGTGTGTCGG + Intronic
953412910 3:42700360-42700382 CTGTGTGTGTGTGTGTGTGTCGG + Intronic
953758482 3:45667595-45667617 CTGTGTGTGTGTATGTGTTTAGG + Intronic
954003453 3:47575672-47575694 CTGTGTGAGTGGCTGCATTTTGG + Intronic
954381687 3:50222209-50222231 GTGTGTATGTGTATGCATGGGGG - Intergenic
954583672 3:51717304-51717326 CTGTGTAAGTGCATGTATGTGGG - Intronic
954904087 3:54044843-54044865 GTATGTGTGTGGATCTATGTTGG + Intergenic
955148716 3:56345767-56345789 CTAAGTGTGGGCATGCATGTGGG - Intronic
956715158 3:72072814-72072836 GTGTGTGTGTGTATGTGTGTAGG + Intergenic
956744515 3:72300914-72300936 GTGTGTGTGTGTGTGTATGTCGG + Intergenic
956745107 3:72304919-72304941 ATTTTTGTGTGGATGGATGTAGG - Intergenic
957140893 3:76355054-76355076 GTGTGTGTATGTATGCATGGGGG + Intronic
957422487 3:79989402-79989424 CTTTGTGTGTGCATGTAGGTAGG - Intergenic
957508977 3:81162858-81162880 ATGTATGTATGTATGCATGTAGG - Intergenic
957738988 3:84238267-84238289 CTGTGTGTGTGTATGGGTGGGGG - Intergenic
957764247 3:84601065-84601087 GTGTGTGTGTGCGTGTATGTGGG + Intergenic
958170665 3:89935618-89935640 CTTTGTGTGTGTATATATGTTGG + Intergenic
958189098 3:90161836-90161858 TTCTGTGTGGGGATGGATGTTGG - Intergenic
958411412 3:93821473-93821495 TTCTGTGTGGGGATGGATGTTGG - Intergenic
958888190 3:99752685-99752707 GTGTGTGTGGGGGGGCATGTGGG - Intronic
959139761 3:102471551-102471573 TTGTGTGTGTGTATGTGTGTAGG - Intronic
959220154 3:103507942-103507964 CTGGGTGTGGTGGTGCATGTTGG - Intergenic
959223813 3:103556181-103556203 GTGTGTGTGTTTGTGCATGTGGG + Intergenic
959232936 3:103680486-103680508 TTGTGTGTGTGCATGCATTAAGG - Intergenic
959246526 3:103877110-103877132 CTCTGTGTGTGTGTGCATGTTGG + Intergenic
959487752 3:106947367-106947389 GTGTGTGTGTGTATGCATGCAGG - Intergenic
959639736 3:108619268-108619290 CTGTGTGTGTGTATGTGTGTGGG + Intronic
959720536 3:109482218-109482240 GTGTGTGTGTGTGTGCATGCTGG + Intergenic
960038028 3:113121213-113121235 GTGTGTGCGTGCATACATGTTGG - Intergenic
960038405 3:113124646-113124668 CTGTGTGTGTGTGTGGGTGTGGG - Intergenic
960348396 3:116563554-116563576 CTGTGTGTGTGTGTGTGTGTAGG + Intronic
960555347 3:119022654-119022676 GTCTGTGTGTGTATGTATGTAGG - Intronic
961103558 3:124222011-124222033 CTGTGAGTGGGGGTGCAGGTGGG + Intronic
961184815 3:124905619-124905641 GTGTGTGTGTGGTTGTGTGTTGG + Exonic
961456170 3:127025128-127025150 CTGTGAGTTTGGATGAACGTAGG + Intronic
961536658 3:127574846-127574868 ATGTGTGTATGCATGCATGTGGG + Intronic
961917974 3:130397226-130397248 ATGTGTGTGCGCATGCATGTGGG - Intronic
962123402 3:132588211-132588233 ATGTATGTATGTATGCATGTAGG + Intronic
962351860 3:134662132-134662154 CTGGGTGTGGTGATGCATGCTGG + Intronic
962353276 3:134671908-134671930 CAATGTGTGTGGATGTAGGTGGG + Intronic
962533073 3:136301526-136301548 CTGTGTGTGTGGAGGTCCGTGGG + Intronic
962712685 3:138101195-138101217 GTGTGTGTGTGAATGAATGAAGG - Intronic
963322875 3:143828562-143828584 CTGTGTGTGTGTGTGTGTGTTGG - Intronic
963332011 3:143925127-143925149 CTGTGTGTGTATGTGAATGTGGG - Intergenic
963379696 3:144512446-144512468 ATGTGTGTATGTATGCCTGTGGG + Intergenic
963622740 3:147632854-147632876 GTGTGTGTGTGTATGTATATAGG + Intergenic
965055681 3:163711656-163711678 GTATGTGTAAGGATGCATGTGGG - Intergenic
965116677 3:164499399-164499421 CTGTGTGTCTGTGTGTATGTTGG + Intergenic
965164965 3:165186245-165186267 GGGTGTGTGTGGAAGCGTGTGGG + Intergenic
965172548 3:165285341-165285363 ATGTGTGTGTGTATGCAACTAGG - Intergenic
965264508 3:166523585-166523607 GTGTGTGTGTGTATGTGTGTTGG + Intergenic
965381052 3:167988625-167988647 GTGTGTGTGTGGTGGGATGTGGG - Intergenic
965635905 3:170780242-170780264 CTGTGTTTCTGGATGCAGGAGGG - Intronic
966052354 3:175636080-175636102 GTGCGTGTGTGTGTGCATGTAGG - Intronic
966075365 3:175930404-175930426 CTCTCTGTGTTGATACATGTGGG - Intergenic
966547725 3:181169822-181169844 ATGTGTGTGTGCATGCATATTGG - Intergenic
966645234 3:182238803-182238825 CTGTGTGTGGGGGTGTGTGTGGG - Intergenic
966846318 3:184133454-184133476 GTGTGTGTGTGTGTGTATGTAGG + Intergenic
967158519 3:186714995-186715017 CTGTGTGTGTGTATGCATATGGG - Intergenic
967290364 3:187913918-187913940 ATGTGTTTGTGTATGCATGTAGG + Intergenic
967532774 3:190568125-190568147 CCGTGTGTGTGCCTGCATTTTGG - Intronic
967680608 3:192358474-192358496 GTGTGTGTGTGTGTGTATGTGGG + Intronic
967798768 3:193630204-193630226 CTGTGTGTGTTTATGCAGGATGG - Intronic
967889183 3:194352917-194352939 GTGAGTGTGAGGATGTATGTGGG + Intergenic
967935346 3:194723239-194723261 GTGGGTGTGTGTTTGCATGTGGG + Intergenic
967988280 3:195112503-195112525 GTGTGTGTGTGGGTGTGTGTGGG - Intronic
968194522 3:196695419-196695441 CTGTGGGTGTGGGTGTGTGTGGG - Intronic
968194545 3:196695506-196695528 TGGGGTGTGTGGGTGCATGTGGG - Intronic
968360694 3:198144803-198144825 TTCTCTGTGTGGATGCAGGTGGG + Intergenic
968518712 4:1025632-1025654 CTGTGCGTGTGCGTGCATTTGGG - Exonic
968955089 4:3714574-3714596 GTGTGTGTGTGCATGTGTGTGGG + Intergenic
968978517 4:3834427-3834449 CTGTGTGGGTGGATGGAGGGTGG - Intergenic
969155422 4:5205718-5205740 GTGTGTGTGTGTGTGCATTTAGG + Intronic
969230286 4:5825880-5825902 GTCTGTATGTGTATGCATGTGGG - Intronic
969505664 4:7585760-7585782 CTGTTTGGGAGGACGCATGTGGG + Intronic
969800890 4:9564367-9564389 GTGTGTGTGTGCATGTATGTAGG - Intergenic
969959652 4:10931142-10931164 ATGTGTGTGTGTATGAGTGTGGG - Intergenic
970025770 4:11622516-11622538 ATGTGTATGTGTATGCATGATGG - Intergenic
970068066 4:12121965-12121987 GTGTGTGTGTGCATGCACATGGG - Intergenic
970187440 4:13474226-13474248 ATGTGTGTGTGTGTGCATTTGGG + Intronic
970273988 4:14377749-14377771 GTGTGTGTGTGTGTGTATGTAGG + Intergenic
970337963 4:15072120-15072142 GTGTGTGTGTGCATACATGGGGG - Intergenic
970651925 4:18188229-18188251 GTGTGTGTGTCCATGTATGTGGG + Intergenic
970668667 4:18368832-18368854 GTGTGTGTGTATATACATGTAGG - Intergenic
970735734 4:19165267-19165289 GTGTGTGTGTGCATGCGTGAAGG - Intergenic
970830165 4:20328900-20328922 ATGTCTGTGTGTCTGCATGTGGG + Intronic
971097235 4:23421280-23421302 GTGTGTGTGTGGATGTGTGTGGG + Intergenic
971125517 4:23749859-23749881 CTGTGTGTGTGTCTGCTTTTGGG - Intergenic
971130274 4:23801246-23801268 CTTTGTGTGTGTATGTATGCAGG - Intronic
971154902 4:24071207-24071229 GTGTGTTTGTGCATGCATGTGGG - Intergenic
971547666 4:27907620-27907642 ATGTATGTGTGTATGCATGTTGG - Intergenic
971571388 4:28215600-28215622 GTGTGTGTGTGTGTGTATGTAGG + Intergenic
971639258 4:29108535-29108557 ATGTGTGTGTGTATTCATATAGG + Intergenic
971766021 4:30833111-30833133 TTGTGTGTGTGCATGCATGTGGG + Intronic
971853272 4:32010940-32010962 CTGTGTGTGTTTTTACATGTAGG - Intergenic
971936247 4:33151871-33151893 GTGTATGTGTGTATGCATGTAGG + Intergenic
972038926 4:34565264-34565286 ATGTGTGTGTGTGTGCATGCAGG - Intergenic
972046282 4:34668471-34668493 TTGTGTGTGAGTATGTATGTGGG + Intergenic
972099977 4:35403043-35403065 GTGTGTGTGTGTATGTGTGTAGG + Intergenic
972197173 4:36667737-36667759 CTGTGTGCGTGTGTGCGTGTTGG - Intergenic
972413634 4:38817585-38817607 ATGTGTGTGTGCATGCACTTGGG - Intronic
972840476 4:42924307-42924329 GTGTGTGTTTGTATGCATGTGGG + Intronic
972940522 4:44189638-44189660 GTGTGTGTGTGCATGTATGTTGG - Intronic
973341630 4:49011363-49011385 ATGTGTGTGTGCATGCAAGATGG + Intronic
973394557 4:49582056-49582078 CTGTGTGTGTTTACACATGTGGG + Intergenic
973866648 4:55120860-55120882 GTGTGTGTGTGTATGCATGTTGG + Intronic
974191952 4:58516670-58516692 GTGTGTGTGTGTGTGTATGTTGG - Intergenic
974672029 4:65044569-65044591 GTGTGTGTGTGTGTGTATGTGGG + Intergenic
975011736 4:69363507-69363529 GTGTCTGTGTGTCTGCATGTGGG - Intronic
975293021 4:72699474-72699496 GTGTGTGTGTGTATGTATGTTGG - Intergenic
975408252 4:74017164-74017186 TTGTGTGTGTGGATGTATATAGG + Intergenic
975735193 4:77373732-77373754 CTGTGTGTGTGTTTGGAGGTGGG + Intronic
976689763 4:87856097-87856119 GTGTGTGTGTGCATGTGTGTTGG - Intergenic
976841659 4:89438984-89439006 GTGTGTGTGTGTGTGCATTTGGG + Intergenic
976869000 4:89767997-89768019 TTTTGTGTGTGGATGTGTGTTGG + Intronic
976987293 4:91317606-91317628 GTGTGTGTGTGTGCGCATGTGGG + Intronic
977307985 4:95349331-95349353 GTGTGTGTGTGGGTGTGTGTGGG + Intronic
977442709 4:97089560-97089582 CTGTGTGTGTGTGTGCGTGGGGG - Intergenic
977482004 4:97590616-97590638 CTGTGTGTCTGTGTGTATGTAGG - Intronic
978708966 4:111753670-111753692 GTGTGTGTGTGCATGCCTGTGGG - Intergenic
978738990 4:112116461-112116483 GTGTGTGTGCGTGTGCATGTTGG + Intergenic
978856381 4:113399169-113399191 ATGTGTGTGTGTATGCATGGGGG - Intergenic
979222909 4:118249725-118249747 GTGTGTGTGTGTGTGTATGTGGG - Intronic
979279253 4:118846901-118846923 CCGTGTGTGTGGGTGGAGGTGGG - Intergenic
979459594 4:120966598-120966620 GTGTGTGTGTGTGTGCATGCAGG + Intergenic
979535420 4:121814425-121814447 TTGTGTGTGTGTATGTATGTGGG + Intronic
979608773 4:122668609-122668631 CTGAGTGTGTGCGTGCGTGTTGG + Intergenic
979854430 4:125613381-125613403 CTGTGTGTGTATGTGTATGTGGG - Intergenic
980097436 4:128505983-128506005 CTGTGTGTGTGTATGATTGGGGG + Intergenic
980129147 4:128802709-128802731 TTTTGTGTGTGTGTGCATGTCGG - Intergenic
980208162 4:129748940-129748962 GTGTGTGTGTGCATGCGTGCAGG + Intergenic
980597705 4:134976157-134976179 GTGTGTGTGTGTGTGTATGTGGG + Intergenic
980791514 4:137626613-137626635 GTGTGTGTGTGTGTGTATGTTGG + Intergenic
980843360 4:138293870-138293892 GTGTGTGTGTGTGTGTATGTTGG - Intergenic
980897213 4:138871536-138871558 CTGTGTGTGTGTACACATGCAGG + Intergenic
980980570 4:139651355-139651377 GTGTGTGTGTGTGTGCGTGTTGG + Intergenic
981187247 4:141817945-141817967 CTCTGTGTGTCTTTGCATGTGGG - Intergenic
981717582 4:147766649-147766671 CAGTGTGTGTGGGTGTGTGTGGG - Intronic
981817413 4:148847006-148847028 GTGTGTGTGTGTATGTATCTTGG + Intergenic
983264918 4:165498753-165498775 GTGTGTGTGTGTGTGCATGGTGG + Intergenic
983474901 4:168202128-168202150 GTGTGTGTGTGTATGCGTGTTGG - Intergenic
983665981 4:170183689-170183711 GTGTGTGTGTGTGTGTATGTAGG + Intergenic
983971359 4:173878873-173878895 CTGCGTGTCTGAATGCACGTGGG - Intergenic
984374992 4:178918406-178918428 GTGTGTGTGTGTAGGCACGTTGG - Intergenic
984376006 4:178930898-178930920 ATCTGTGTGTGTATGTATGTGGG - Intergenic
984413989 4:179433725-179433747 GTGTGTGTGTGTGTGTATGTTGG + Intergenic
984848446 4:184129285-184129307 GTGTGTGTGTGTGTGTATGTTGG - Intronic
984963452 4:185120496-185120518 GTGTGTATGTGGGTGTATGTAGG + Intergenic
985010442 4:185577147-185577169 GTGTGTGTGTGGAAGGATGTCGG + Intergenic
985181690 4:187271935-187271957 GTGGGTGTGTGGGTGAATGTGGG - Intergenic
985181710 4:187272073-187272095 GTGTGAGTGTGGATGAGTGTGGG - Intergenic
985377932 4:189361912-189361934 GTGTGTGTGTGCGCGCATGTAGG - Intergenic
985383851 4:189424649-189424671 GTGTGTGTGTGTATGCATACAGG - Intergenic
985515986 5:344803-344825 CTGTGTGTGCGGGTGTGTGTGGG + Intronic
985565879 5:616994-617016 CAGTGTGTGTGGTTGCAGGAGGG + Intronic
985624705 5:979159-979181 GTGTGTGTGTGCATGGGTGTGGG - Intergenic
985659601 5:1150315-1150337 AGGTGTGTGTGCATGGATGTCGG - Intergenic
985833786 5:2256220-2256242 CTCTGTATGTGCATGCATATGGG + Intergenic
985842162 5:2315633-2315655 ATGTATGTGTGTATGTATGTAGG + Intergenic
985907120 5:2847979-2848001 TTGTGTGTGTGTATTAATGTTGG - Intergenic
985929324 5:3044312-3044334 GTGTGTGCGTGTGTGCATGTGGG + Intergenic
985949392 5:3211714-3211736 GTATGGGTGTGCATGCATGTGGG + Intergenic
985949458 5:3212378-3212400 GTATGTGAGTGGGTGCATGTAGG + Intergenic
986153648 5:5151714-5151736 GTGTGTGTGTGTATGTGTGTGGG + Intronic
986341063 5:6789649-6789671 CTGTGTGTGTGCGTACATGCAGG + Intergenic
986517902 5:8582441-8582463 CTGTGTGTGAGGATGGTTGTTGG + Intergenic
986719992 5:10554135-10554157 GTGTGTGTGTGTGTGCATGCAGG + Intergenic
986746846 5:10752704-10752726 TTGTGTGTGTGGCTGTGTGTGGG + Intronic
986806471 5:11312665-11312687 GTGTGTGTGAGTGTGCATGTGGG - Intronic
987026082 5:13927954-13927976 ATGCGTGTGTGGGTCCATGTGGG - Intronic
987051612 5:14151402-14151424 GTGTGTGTATGTATGTATGTAGG + Intronic
987410558 5:17610803-17610825 CAGTGTGTGTGTTTGCATGTGGG + Intergenic
987443722 5:17989744-17989766 GTGTGTGTGTGGGTGGGTGTGGG + Intergenic
987468635 5:18303298-18303320 GTGTGTGTGTGTATGTGTGTGGG - Intergenic
987554310 5:19427091-19427113 GTGTGTGTGTGTATGCCTGAGGG + Intergenic
987637287 5:20560458-20560480 GTGTGTGTGTGTATGAGTGTTGG - Intronic
987655793 5:20804238-20804260 GTGTGTGCGTGCATGTATGTAGG + Intergenic
987925112 5:24330843-24330865 CTGTATGTATGTATGTATGTAGG + Intergenic
988125871 5:27035700-27035722 GTGTGTGTGTGGGTGTGTGTGGG + Intronic
988161948 5:27529841-27529863 CTGTGGGTGTTGTTACATGTGGG + Intergenic
988700740 5:33672128-33672150 ATGTGTGTGTGTATGTATGTGGG - Intronic
988722235 5:33890683-33890705 GTGTGCGTGTGCATGCGTGTGGG + Intronic
988767761 5:34399670-34399692 GTGTGTGCGTGCATGTATGTAGG - Intergenic
988935769 5:36081586-36081608 GTGTGTGTGTGCATGTGTGTGGG - Intergenic
989078415 5:37589239-37589261 GTGTGTGTGTGTATGTGTGTAGG - Intronic
989310730 5:40014301-40014323 CTGTGTGTGTGTATGTGTGTGGG - Intergenic
989452302 5:41600825-41600847 CTGAGTGTGTGGCTGCTTGCAGG + Intergenic
989756000 5:44955136-44955158 GTGTGTGTGTGTGTGTATGTGGG - Intergenic
989780002 5:45253408-45253430 GTGTGTGTGTGTGTGTATGTGGG + Intergenic
989957619 5:50374727-50374749 CTGTATCTGGGGATCCATGTTGG - Intergenic
990553529 5:56908573-56908595 GTGTGCGTGTGCATGCATCTGGG + Intergenic
990615030 5:57499015-57499037 CTGTGTGTGTGTGTGTGTGTAGG + Intergenic
990687437 5:58321786-58321808 CTGTGTGTGTGTGTGTGTGTAGG + Intergenic
991000487 5:61777788-61777810 TTGTGTGTGTGGATGTGTGAGGG - Intergenic
991008283 5:61854034-61854056 CTGGGTGTGTGGAGGCCTGAGGG - Intergenic
991040121 5:62166846-62166868 CTGTGTGTGTGGAGGTGGGTGGG - Intergenic
991246653 5:64515701-64515723 GTGTGTGTGTGTATGCATATAGG - Intronic
991678150 5:69109443-69109465 ATGTATGTATGTATGCATGTAGG + Intronic
991726829 5:69543847-69543869 ATGTGTGTGTAGATGCAGGTGGG - Intronic
991868128 5:71084027-71084049 ATGTGTGTGTAGATGCAGGTGGG + Intergenic
992083105 5:73253778-73253800 CTGTGTGTGTGGGTAGGTGTAGG - Intergenic
992199150 5:74367266-74367288 CTGGGTGTGTCCACGCATGTGGG - Intergenic
992334032 5:75747065-75747087 GTGTGTGTGTGTATGCATAATGG + Intergenic
992368102 5:76113911-76113933 GTGTGTGTGTGTATGATTGTGGG - Intronic
993130079 5:83885713-83885735 CTGTGTGAATGGAACCATGTGGG + Intergenic
993523744 5:88938500-88938522 TTGTGTGTGTGAATGAATGAAGG + Intergenic
993589128 5:89772152-89772174 GTGTGTGTGTGTACGCATGTGGG - Intergenic
993927860 5:93893357-93893379 TTGTATGTGTGTATGCATTTTGG - Intronic
994172438 5:96672269-96672291 CTGTGTGTGTGTATGCAAATAGG + Intronic
994206858 5:97044988-97045010 TTGTGTGTGTGTGTGAATGTGGG + Intergenic
994265873 5:97715659-97715681 CTGTGTGTGTGCATGTTTGGTGG - Intergenic
994548052 5:101193968-101193990 GTGTGTGTGTATATGTATGTAGG - Intergenic
994755134 5:103786002-103786024 TTGTCTGTATGGATGGATGTAGG + Intergenic
995017268 5:107325234-107325256 TTGAGTGTGTGTGTGCATGTAGG - Intergenic
995178233 5:109203969-109203991 CTGTGTGTTTGAATGCCTGTTGG - Intergenic
995232257 5:109780538-109780560 GTGTGTGTGTGTATGTGTGTAGG + Intronic
995407041 5:111809901-111809923 GTGTGTGTGTGTATTCATGGTGG + Intronic
995721697 5:115141769-115141791 GTGTGTGTGTGTGTGCACGTGGG - Intronic
996249480 5:121311322-121311344 CTATGTGTGTGTATGTATGTGGG + Intergenic
996409521 5:123143163-123143185 GTGTGTGTGTGTGTGTATGTGGG + Intronic
996537011 5:124587995-124588017 GTGTGTGTGTGTGTGCATGCTGG - Intergenic
996916108 5:128713963-128713985 GTGTGTGTGTGCATGAGTGTTGG - Intronic
996936969 5:128960591-128960613 CTATGTGTGTCTCTGCATGTGGG + Intronic
997024024 5:130036781-130036803 CTGTGTGTGTGGCTGTGGGTGGG + Intronic
997432020 5:133847397-133847419 CTGTGTGTGTGGCTCCCTGGAGG - Intergenic
997623572 5:135316647-135316669 CTGTGTGAGTGCATGCACGATGG + Intronic
997646897 5:135487886-135487908 GTGTGTGTGTGCATGTGTGTTGG + Intergenic
998128754 5:139640661-139640683 CTGTGTGTGGGGAGGAATGAGGG + Intergenic
998542769 5:142998497-142998519 CTGTGTTTGTAAATGTATGTTGG + Intronic
998811270 5:145968480-145968502 ATGTGTTTGTGCATGTATGTGGG + Intronic
998835462 5:146198804-146198826 GTGTGTGTGTGTCTGCATATAGG + Intergenic
998934065 5:147215851-147215873 GTGTGTGTGTGCATGTGTGTTGG + Intergenic
999314982 5:150577548-150577570 GTGTGTGGGTGCGTGCATGTGGG + Intergenic
999366736 5:151028295-151028317 ATGTGGGTGTGGGTGCATGTGGG + Exonic
999473960 5:151880926-151880948 CTGTGAGTTTGCATACATGTAGG - Intronic
999530802 5:152461599-152461621 GTGTGTGTGTGTATGTATATAGG + Intergenic
999826480 5:155278260-155278282 ATGTGTGTGTGGGTGTGTGTAGG - Intergenic
999859605 5:155631735-155631757 CTGTGTGTGTGGACTCATGCAGG + Intergenic
999866356 5:155704563-155704585 GTGTGTGTGTGTGTGCATTTTGG - Intergenic
999937958 5:156508345-156508367 CTGTGTGTGTGGATGACTAGGGG + Intronic
1000189152 5:158892073-158892095 ATGTGTGTGTGTGTGCATATAGG - Intronic
1000212173 5:159117819-159117841 GTGTGTGTGTGTGTGTATGTTGG - Intergenic
1000381191 5:160631053-160631075 ATGTGTGTGTGTATTCATGGGGG + Intronic
1000438181 5:161239170-161239192 GTGTGTGTATGTATGTATGTGGG - Intergenic
1000799232 5:165703862-165703884 GTGTGTGTGTGTATGTGTGTTGG + Intergenic
1000850233 5:166330900-166330922 CTGTGTGTTTGGGTGTGTGTGGG + Intergenic
1000924196 5:167173719-167173741 GTGTGTGTGTGTGTGTATGTGGG + Intergenic
1001009036 5:168081316-168081338 CTGTGTGTGTCTCTGCATGTGGG + Intronic
1001469876 5:172004860-172004882 GTGTGTGTGTGTGTGCACGTGGG - Intronic
1001533918 5:172485234-172485256 GTGTGTGTGTGCATGTGTGTGGG + Intergenic
1001550156 5:172596679-172596701 GTGTGTGTGTGCATACATGTGGG - Intergenic
1001571986 5:172736093-172736115 GTGTGTGTGTGTGTGCATGCAGG - Intergenic
1001939667 5:175731593-175731615 CTGTGTGTGTGTATGGTGGTGGG - Intergenic
1001987868 5:176091018-176091040 ATGTGTATGTGGAAGTATGTTGG + Intronic
1002082488 5:176745789-176745811 GTGTGTGTGTCGATGCAGGAAGG + Intergenic
1002229004 5:177747123-177747145 ATGTGTATGTGGAAGTATGTTGG - Intronic
1002266342 5:178036660-178036682 ATGTGTATGTGGAAGTATGTTGG + Intronic
1002345936 5:178547588-178547610 GTGTGTGTGTGGGTGGTTGTGGG - Intronic
1002350274 5:178578056-178578078 ATGAGTGTGTGTGTGCATGTGGG - Intronic
1002394917 5:178945228-178945250 CTGTGTGTGTATTTGTATGTTGG + Intronic
1002633368 5:180595370-180595392 GTGTGTGTGTTGTTGCATTTAGG + Intergenic
1002741135 5:181436650-181436672 ATGTGTGTGTCTAGGCATGTGGG - Intergenic
1002918999 6:1552713-1552735 GTGTGTGTGTGTGTGTATGTGGG + Intergenic
1003125488 6:3352416-3352438 GTGTGTCTGTGCATGCATGCCGG - Intronic
1003528240 6:6916420-6916442 GTGTGTGTGTGGGTGTGTGTGGG + Intergenic
1004075183 6:12338619-12338641 CTGTGTGCATGAAGGCATGTTGG - Intergenic
1004237177 6:13884520-13884542 ATGTGTGTGTGTGCGCATGTGGG + Intergenic
1004739900 6:18448681-18448703 GTGTGTGTGTGTGTGCATGCTGG - Intronic
1004867301 6:19866786-19866808 GTGTGTGTGTGCATGTGTGTTGG + Intergenic
1004952870 6:20694078-20694100 GTGTGTGTGTGTGTGTATGTAGG + Intronic
1005280664 6:24270461-24270483 ATATGTGTGTGTGTGCATGTAGG - Intronic
1005301349 6:24474168-24474190 GTGTGTGTGTGTGTGTATGTGGG - Intronic
1005536489 6:26762154-26762176 GGGTGTGTGTGCATGGATGTAGG - Intergenic
1005573702 6:27172158-27172180 GTGTGTGTGTGTATGTATATAGG - Intergenic
1005706753 6:28462583-28462605 CTGTGTGTGTGTGTGTGTGTGGG - Intergenic
1006449320 6:34096938-34096960 GTGAGTGTGTGCATGCACGTGGG + Intronic
1006517944 6:34555041-34555063 GTGTGCGTGTGTGTGCATGTTGG - Intronic
1006990425 6:38210566-38210588 GTGTGTGTGTGTCTGCATCTGGG + Intronic
1007110549 6:39311065-39311087 GTGTGTGTGTGTGTGCATCTTGG - Intronic
1007165700 6:39827552-39827574 CTGTGTGTGTGGGCTCATGGAGG + Intronic
1007231773 6:40353226-40353248 ATGTGAGTGTGTGTGCATGTTGG - Intergenic
1007321543 6:41031922-41031944 CTGTGTGCATGGCTGCATGGGGG + Intronic
1007355197 6:41309985-41310007 CTATGTGTGTGCGTGTATGTGGG + Intergenic
1007388059 6:41532541-41532563 GTGTGTGTATGCGTGCATGTGGG + Intergenic
1007729411 6:43936812-43936834 ATGTGTGCGTGGGTGCTTGTGGG - Intergenic
1007805073 6:44437152-44437174 TTCTGTGTGTGGATGGGTGTTGG + Intronic
1007876514 6:45108717-45108739 CTGTGTATGTGGTTTCCTGTAGG - Intronic
1008151113 6:47952498-47952520 ATGTGGGTGTGGTTGCATGGGGG - Intronic
1008371093 6:50731439-50731461 GTGTGTGTGTGTATGAAAGTGGG - Intronic
1008378815 6:50820421-50820443 GTGTATGTGTGGAGGTATGTAGG + Intronic
1008383713 6:50862684-50862706 GTGTGTGTGTGTGTGCATCTTGG - Intergenic
1008920652 6:56841836-56841858 GTGTGTGTGTGTGTGTATGTGGG - Intronic
1008981599 6:57489854-57489876 CTGTGTATGTGGTTTCGTGTAGG + Intronic
1009169669 6:60382685-60382707 CTGTGTATGTGGTTTCGTGTAGG + Intergenic
1010178077 6:73052811-73052833 CTGTTTGTGTGGTTGCTTTTTGG - Intronic
1010594811 6:77750378-77750400 CTATGTGTGTCTTTGCATGTGGG - Intronic
1010658943 6:78546366-78546388 GTGTGTGTGTGTATACATGGTGG + Intergenic
1010979733 6:82358224-82358246 GTCTGTGGGAGGATGCATGTAGG - Intergenic
1011233901 6:85193626-85193648 GTGTGTGTGTGTATGTCTGTTGG - Intergenic
1011499096 6:87968147-87968169 CTGTGTGTGTGTGTGTGTGTAGG + Intergenic
1011595298 6:89010230-89010252 GTGTGTGTGTGCATGTGTGTGGG - Intergenic
1011625423 6:89279379-89279401 GTGTGTGTGTGCATGCATGCGGG + Intronic
1011837751 6:91455009-91455031 TTGTGTGTATGTTTGCATGTGGG + Intergenic
1011888267 6:92125152-92125174 CTGTGTGTGTGAGCGCATGTTGG + Intergenic
1012321730 6:97856091-97856113 CACTCTGTCTGGATGCATGTTGG - Intergenic
1012357636 6:98335677-98335699 CAGTGTGTGAGTGTGCATGTGGG - Intergenic
1012386110 6:98685203-98685225 GTGTGTGTGTGGGTGTGTGTGGG + Intergenic
1012488526 6:99750436-99750458 CTGTTTGTGTGTATGTGTGTTGG + Intergenic
1012636901 6:101554313-101554335 TTGTGTCTCTGAATGCATGTTGG - Intronic
1013256252 6:108389261-108389283 CTGTGTGTGTCTCTGCACGTGGG + Intronic
1013398727 6:109770422-109770444 ATGTGTGTATGCATGCATGGAGG + Intronic
1013409188 6:109869001-109869023 AGGTGTGTGGGCATGCATGTTGG + Intergenic
1013703714 6:112806847-112806869 GTGTGATTGTGTATGCATGTGGG - Intergenic
1013895299 6:115080945-115080967 GTGTGTGTGTATATGTATGTAGG - Intergenic
1013895363 6:115081588-115081610 GTGTGTGGGTGTATGTATGTAGG + Intergenic
1013895375 6:115081698-115081720 GTGTGTGTTTGTATGTATGTAGG + Intergenic
1014042320 6:116843179-116843201 CTCTGTGAGAGGAAGCATGTGGG - Intergenic
1014190549 6:118491186-118491208 GTGTGTGTGTGTATAGATGTTGG - Intronic
1014460731 6:121692336-121692358 GTGTGTGTGTGTGTGCGTGTTGG + Intergenic
1016180494 6:141141356-141141378 GTGTGTGTGTGCACGCATGCAGG - Intergenic
1016640338 6:146341013-146341035 CCATGTGTGTGCATGCATGTGGG - Intronic
1016724169 6:147341663-147341685 TTGTGTGTGTGGGTGTGTGTGGG + Intronic
1016772314 6:147865240-147865262 GTGTGTGTGTGTATGTGTGTAGG + Intergenic
1016866788 6:148775534-148775556 ATGTGTATGTGTGTGCATGTGGG + Intronic
1016922524 6:149309862-149309884 CTGTGTGTGTGTGTGGGTGTGGG + Intronic
1017322505 6:153110419-153110441 GTGTGTGTGTGTGTGTATGTTGG - Intronic
1017708359 6:157145326-157145348 CTGTGTGTGTGGCTGCTTTGGGG + Intronic
1018067989 6:160137099-160137121 GTGTGTGCGTGGGTCCATGTGGG - Intronic
1018269044 6:162056113-162056135 TGGTGTGCGTGCATGCATGTGGG - Intronic
1018297092 6:162360083-162360105 GTGTGTGTGTGGGTGGGTGTGGG + Intronic
1018378844 6:163239745-163239767 GTGTGAGTGTGTGTGCATGTGGG - Intronic
1018412435 6:163565022-163565044 CTGTGTGTGTGCATGCACTCAGG + Intronic
1018483360 6:164214331-164214353 CTGTGTGTGTGGAAGGCAGTTGG + Intergenic
1018661120 6:166088062-166088084 GTGTGTGTGTGGTTGTGTGTGGG + Intergenic
1018712649 6:166507819-166507841 ATGTGAGTGTGTGTGCATGTGGG - Intronic
1018765586 6:166930454-166930476 GTGTGTGTGTACATGCATGTGGG - Intronic
1018765590 6:166930541-166930563 CTCTGTGTGAACATGCATGTGGG - Intronic
1018765597 6:166930793-166930815 ATGTGTGTGTACATGCATGTGGG - Intronic
1018765599 6:166930832-166930854 ATGTGTGTGTACATGCATGTGGG - Intronic
1018854360 6:167664912-167664934 ATGTGTGTGCACATGCATGTGGG + Intergenic
1018941552 6:168311499-168311521 TTGTGTGTGTGTATGTGTGTGGG - Intronic
1019092721 6:169553016-169553038 GTGTGTGTGTGTATGCAGGGAGG + Intronic
1019092734 6:169553084-169553106 GTGTGTGTGTGTATGCAGGGAGG + Intronic
1019103340 6:169649765-169649787 ATGTGTGCGTGGATGGATGGAGG - Intronic
1019103395 6:169650010-169650032 ATGTGTGGGTGGATGGATGGAGG - Intronic
1019129594 6:169864043-169864065 CTGTGTGTGTGCCTGTGTGTGGG - Intergenic
1019246249 6:170712347-170712369 ATGTGTGTGTCTACGCATGTGGG - Intergenic
1019259311 7:71829-71851 TTCTCTGTGTGGATGCAGGTGGG - Intergenic
1019305799 7:334260-334282 GTGTGTTTCTGCATGCATGTGGG - Intergenic
1019305807 7:334480-334502 GTGTGTCTCTGCATGCATGTGGG - Intergenic
1019431372 7:1001339-1001361 CTGTGGGTGTGGAGCCCTGTGGG + Intronic
1019431399 7:1001423-1001445 CTGTGGGTGGGGATTCCTGTGGG + Intronic
1019431515 7:1001813-1001835 CTGTGGGTGTGGAGCCCTGTGGG + Intronic
1019431663 7:1002323-1002345 CTGTGGGTGTGGAGCCCTGTGGG + Intronic
1019433724 7:1011331-1011353 CGGTGTGTGTGGTTGTATGTGGG - Intronic
1019487190 7:1294744-1294766 GTGTGTGTGTGAGTGGATGTGGG + Intergenic
1019487238 7:1294975-1294997 GTGTGTGTGTGTGTGGATGTGGG + Intergenic
1019487248 7:1295026-1295048 GTGTGTGTGTGTGTGGATGTGGG + Intergenic
1019487307 7:1295317-1295339 GTGTGTGTGTGTGTGGATGTGGG + Intergenic
1019487325 7:1295400-1295422 GTGTGTGTGTGTGTGGATGTGGG + Intergenic
1019601789 7:1887629-1887651 GTGTGTGCATGCATGCATGTGGG + Intronic
1019862950 7:3677206-3677228 ATGTGTGTGTGTGTGCATGTAGG + Intronic
1020214573 7:6179895-6179917 GTGTGTGTGTGGTTGTGTGTGGG - Intronic
1020876883 7:13708101-13708123 CGGTGTGTTTGGATGCTTTTCGG - Intergenic
1021043298 7:15890264-15890286 GTGTGTGTGTGCCTGCTTGTGGG - Intergenic
1021095192 7:16527458-16527480 GTGTGTGTGTGTGTGGATGTGGG + Intronic
1021126534 7:16856828-16856850 GTGTGTGTGTGTATACATATAGG - Intergenic
1021194695 7:17662399-17662421 GTGTGTGTGTAGGTGTATGTGGG - Intergenic
1021280320 7:18708919-18708941 GTGTGTGTGTGCATGTGTGTGGG - Intronic
1021284090 7:18757738-18757760 CTCTGTGTGTGGGTGGGTGTGGG + Intronic
1021434087 7:20594680-20594702 GTGTGTGTGTGTGTGTATGTTGG - Intergenic
1021669065 7:23016488-23016510 GTGTGTGTGTGCATGCGCGTAGG - Intergenic
1021896405 7:25240085-25240107 GTGTGTGTGTGTATGTGTGTGGG + Intergenic
1022020579 7:26396965-26396987 CTGGGTGTGTGGGTGCAGGAGGG + Intergenic
1022134665 7:27436084-27436106 ATGTGTGGGTGGATGTAGGTGGG - Intergenic
1022134667 7:27436088-27436110 GTGTATGTGTGGGTGGATGTAGG - Intergenic
1022212487 7:28225197-28225219 GTGTGTCTGTGTGTGCATGTGGG - Intergenic
1022275875 7:28854681-28854703 GTGTGTGTTTGTGTGCATGTGGG - Intergenic
1022529911 7:31060510-31060532 GTGTGTGTGTGGTTGCCTGTCGG + Intronic
1022548555 7:31212761-31212783 GTGTGTGTGTGTGTGTATGTGGG + Intergenic
1022646289 7:32231306-32231328 GTGTGTGTGTGTATTTATGTTGG - Intronic
1022751714 7:33234688-33234710 GTGTGTGTGTGGATAGATGGAGG - Intronic
1023459163 7:40375878-40375900 CTGTGTTTGTGAATGAATGGAGG + Intronic
1023575561 7:41622660-41622682 CTGTGTGAATGGAAGCTTGTTGG + Intergenic
1023630975 7:42164073-42164095 CTGTGTTTTTGCATGCATTTTGG - Intronic
1023847223 7:44129213-44129235 CTGTGTGTGTATGTGCATGTGGG - Intergenic
1024019618 7:45354372-45354394 TGGTGTGTGTGGATGTATGTAGG - Intergenic
1024293787 7:47827031-47827053 TTGTGTGTGTGAATCCATGCTGG + Intronic
1024385084 7:48741813-48741835 CTGTGTGAGTGGATTTTTGTTGG + Intergenic
1024438241 7:49384081-49384103 GTGTGTGTGAGCGTGCATGTTGG + Intergenic
1024529886 7:50382924-50382946 CTGTGTGTGTATGTGCATGGGGG - Intronic
1024712262 7:52029430-52029452 GTGTGGGTGTGGATGGATGGTGG - Intergenic
1024934118 7:54695624-54695646 GTGTGTGTGTGGGTGGGTGTGGG - Intergenic
1025623214 7:63193377-63193399 GTGTGTGTATGAGTGCATGTTGG - Intergenic
1025735564 7:64143702-64143724 ATGGGTGTGTGGATGGATGGAGG + Intronic
1025920233 7:65905054-65905076 ATATGTGTGTGTATGTATGTAGG - Intronic
1026885406 7:73939460-73939482 CTCTGTTTTTGGATGCATATAGG + Intergenic
1026904255 7:74053824-74053846 ATGTGTGGGTGGATGGGTGTGGG + Intronic
1026975664 7:74496391-74496413 ATGTGGGTGTGTGTGCATGTGGG + Intronic
1026975670 7:74496489-74496511 GTGTGTGTGTGTGTTCATGTGGG + Intronic
1026975689 7:74496594-74496616 GTGTGGGTGTGCATGTATGTGGG + Intronic
1027184244 7:75960838-75960860 CTGTATGTGTGGCTGCCTCTAGG + Intronic
1027521395 7:79213228-79213250 GTGTGTGTGTGTATATATGTGGG + Intronic
1027749190 7:82120199-82120221 GTGTGTGTGTGCATGTGTGTAGG + Intronic
1028035842 7:85980938-85980960 ATGTGTGTGTGGGTGTGTGTGGG - Intergenic
1028224179 7:88230921-88230943 CTGTGTGCGTGCATGTGTGTGGG - Intergenic
1028309688 7:89316011-89316033 GTGTGTCTGTGTATGCATGTGGG + Intronic
1028362159 7:89981676-89981698 GTGTGTGTGTGTGTGTATGTGGG - Intergenic
1028825484 7:95268234-95268256 CTATTTATGTGTATGCATGTTGG - Intronic
1028933848 7:96443697-96443719 CTGTGTGTGTGTGTGTGTGTAGG + Intergenic
1029275352 7:99400695-99400717 CTGTGTGAGTGCTTGCAAGTCGG - Intronic
1029425226 7:100490346-100490368 GTGTGTGTTTGTATGTATGTTGG + Intronic
1029544109 7:101201352-101201374 CTGTGTGTGTTTGTGCATGGCGG - Intergenic
1029842534 7:103381565-103381587 GTGTGTGTGTATATGTATGTAGG - Intronic
1030232732 7:107225032-107225054 CTGTGTGTGTGTATGTATGAGGG + Intronic
1030371648 7:108706804-108706826 GTGTGTGTGTGTATGTGTGTAGG + Intergenic
1031009977 7:116515916-116515938 GTGTGTGTGTGTGTGGATGTAGG - Intergenic
1031144051 7:117978229-117978251 TTGTGTGTGTGGATGTGTGAGGG - Intergenic
1031155132 7:118101030-118101052 GTGTGTGTGTGTGTGCGTGTGGG + Intergenic
1031194397 7:118593566-118593588 GTGTGTATGTGCATGCATGTTGG - Intergenic
1031275053 7:119711312-119711334 GTGTGTGTGTGTGTACATGTAGG - Intergenic
1031367399 7:120919215-120919237 GTGTGTGTGTGTGTGCGTGTGGG + Intergenic
1031814741 7:126419905-126419927 CTGTGTGTGTCTATGTGTGTGGG - Intergenic
1031854299 7:126903555-126903577 GTGTGTGTGTGTATGTATTTAGG - Intronic
1031949742 7:127879909-127879931 ATATGTGTGTGCATGCATGCAGG + Intronic
1031967566 7:128038264-128038286 CTGTGTATGTGGATGCTAGTGGG + Intronic
1031977050 7:128100851-128100873 GTGTGTGTGTAGATGCCTCTTGG + Intergenic
1032013438 7:128361169-128361191 CTGTGTGTGTGAATGTGTGTAGG - Intronic
1032081030 7:128858553-128858575 ATGTGTGTGTGGCTGGAGGTGGG - Exonic
1032086716 7:128887616-128887638 ATGTGTGTGTGGCTGTGTGTGGG - Intronic
1032086753 7:128887998-128888020 CTGTGTGTGGGTGTGTATGTGGG - Intronic
1032086755 7:128888010-128888032 GTGTGTGTGTGGCTGTGTGTGGG - Intronic
1032094122 7:128929177-128929199 CAGTGTCTGAGGATCCATGTGGG + Intergenic
1032189510 7:129756094-129756116 TTGTGTGTGTGCGTGCATGGTGG + Exonic
1032502105 7:132407449-132407471 GTGCATGTGTGCATGCATGTAGG - Intronic
1033117376 7:138637529-138637551 GTGTGTGTGTGTATGTATGTAGG - Intronic
1033158346 7:138975279-138975301 TTGAGTGTGTGGATGCAAGAGGG + Intronic
1033317560 7:140310258-140310280 GTGTGTGTGTGTGTGCATTTGGG - Intronic
1033671762 7:143499958-143499980 CTGGGGCTGTGGATGTATGTGGG - Intergenic
1033821324 7:145138065-145138087 GTGTGTGTGTCTGTGCATGTAGG + Intergenic
1033892809 7:146036302-146036324 TTATATGTGTGCATGCATGTAGG - Intergenic
1034140712 7:148813046-148813068 GTGTGTGTGTGTGTGTATGTGGG - Intronic
1034262214 7:149764282-149764304 GTCTGTGTGTGGATGGAGGTGGG + Intronic
1034423249 7:151000033-151000055 GTGTGAGTGTGGATGTGTGTAGG + Intronic
1034428084 7:151025121-151025143 GTGTGTGTGTGGAGGGAAGTGGG - Intergenic
1034480058 7:151312905-151312927 GTGTGAGTGTGGATGTGTGTGGG + Intergenic
1034858246 7:154574188-154574210 GTGTGTGTGTGTATGTGTGTGGG + Intronic
1034895507 7:154873851-154873873 CTGTGGGTGTGTGTGCATGTGGG - Intronic
1034895518 7:154873989-154874011 GTGTGTGTATGTGTGCATGTGGG - Intronic
1034986926 7:155522072-155522094 CTGTGTGTGTGGATGCATGTGGG - Intronic
1035048701 7:155985631-155985653 CTGTGTGTGTGTGTGTGTGTGGG + Intergenic
1035054500 7:156025274-156025296 GTGTGTGTGTGGATGGGTGTGGG + Intergenic
1035243107 7:157544942-157544964 GTGGGTGTGTGGATGTGTGTGGG + Intronic
1035332665 7:158106463-158106485 GTGTGTGTGTGGAGGCAGGGAGG - Intronic
1035392258 7:158512529-158512551 GTGTGTGAGTGTGTGCATGTGGG - Intronic
1035397848 7:158546802-158546824 CTGTGTGTGCATCTGCATGTTGG - Intronic
1035501822 8:95342-95364 ATGTGTGTGTCTACGCATGTGGG + Intergenic
1035690890 8:1558599-1558621 ATGTGTGTGTGCAGGCATATGGG - Intronic
1035877378 8:3206226-3206248 GTGTGTGTGTGTATGTGTGTGGG + Intronic
1036017079 8:4796913-4796935 CTCTGAGTGTGGCTGCATGGAGG + Intronic
1036028816 8:4942730-4942752 CTGTCTGTGTTGATGAAGGTCGG - Intronic
1036279771 8:7390878-7390900 CTGTGTGTGTAAATGGAGGTAGG - Intergenic
1036341748 8:7921005-7921027 CTGTGTGTGTAAATGGAGGTAGG + Intergenic
1036410330 8:8494011-8494033 GTGTGTGCGTGGATGGATGGTGG + Intergenic
1036548529 8:9795868-9795890 CTGTGTGTTTAGTTGTATGTGGG - Intergenic
1036753201 8:11456098-11456120 CTGTGTGTGTGTGTGAATGTGGG + Intronic
1036753206 8:11456135-11456157 CTGTGTGTGTGTGTGAATGTGGG + Intronic
1036753213 8:11456172-11456194 CTGTGTGTGTGTGTGAATGTGGG + Intronic
1037315068 8:17592905-17592927 GTGTGTGTGTGCATGTATGTGGG - Intronic
1037579765 8:20237403-20237425 GTGTGTGTGTGTATACATGAGGG - Intergenic
1037579776 8:20237585-20237607 TTGTGTGTGTGTATACATGGGGG - Intergenic
1037731830 8:21532514-21532536 GTGTGCATGTGCATGCATGTAGG - Intergenic
1038316114 8:26485692-26485714 CTGGGTGTGTGGATGTTTCTAGG + Intronic
1038516440 8:28191520-28191542 TTATGTGTGTGGATCCATTTGGG - Intergenic
1039064587 8:33597872-33597894 GTGTGTGTGTGTATGCGTGCTGG - Intronic
1039352118 8:36774201-36774223 CTATGTGTGTGGATGAATTGGGG + Intergenic
1039370061 8:36975274-36975296 GTGTGTGTGTGTATGTATGCGGG - Intergenic
1039439099 8:37582224-37582246 GTGTGTGTGTGTGTGTATGTAGG - Intergenic
1039442394 8:37604214-37604236 ATGTGTGTGTGCATGTGTGTTGG - Intergenic
1039470911 8:37813517-37813539 TTGTGTGTGTGTAAGCATTTTGG + Intronic
1039896766 8:41722237-41722259 CTGTGTGTGCTGTTGCATGAGGG - Intronic
1040465134 8:47688035-47688057 GTGTGTGTGTGCATGCGTATAGG + Intronic
1040580736 8:48696546-48696568 CTGTGTGTGCAGGTGCCTGTTGG + Intergenic
1041439043 8:57874294-57874316 CTGTGTGTCCAGATTCATGTAGG + Intergenic
1042074613 8:64978221-64978243 CTGTGTGTGAAAATGCATTTTGG + Intergenic
1042101133 8:65276109-65276131 CTGTATGTGTGGGTGTGTGTGGG + Intergenic
1042413980 8:68498193-68498215 ATGTGTGTGCATATGCATGTGGG - Intronic
1042414209 8:68500625-68500647 GTGTGAGTGTGGATGTGTGTGGG - Intronic
1042504815 8:69548921-69548943 TTGTGTGTGTGTATGTGTGTGGG - Intronic
1042523520 8:69740513-69740535 CTGTGTGTGTGTTTGTATGTGGG + Intronic
1042882777 8:73512641-73512663 GTGTGTGTGTGTATGTGTGTGGG + Intronic
1043073624 8:75668137-75668159 GTGTGTGTGTGTATGTATATAGG + Intergenic
1043292731 8:78623450-78623472 TTGTGTGTGTGTGTGCATTTAGG + Intergenic
1043362199 8:79487115-79487137 ATGTGTTTGTGATTGCATGTAGG - Intergenic
1043552204 8:81386923-81386945 CTGTGGGCTTGGATGCTTGTGGG + Intergenic
1043557397 8:81447747-81447769 GTGTGTGTGTTTAGGCATGTCGG + Intergenic
1044144992 8:88701693-88701715 GTGTGTGTGTGTTTGCGTGTAGG + Intergenic
1044457720 8:92407447-92407469 CTGTCTGTAGGGATGCTTGTTGG + Intergenic
1044730080 8:95222538-95222560 GTGTGTGTGTGTGTGCGTGTAGG + Intergenic
1044834622 8:96283670-96283692 ATGTGTGTGCGTTTGCATGTGGG - Intronic
1045065306 8:98438858-98438880 GTGTCTGAGTGTATGCATGTGGG + Intronic
1045372163 8:101535295-101535317 GTGTGTGTGTGAATGCACTTGGG + Intronic
1045743532 8:105389048-105389070 GTGTGTGTGTGTAGGCATGAGGG + Intronic
1045828766 8:106432694-106432716 TTGTATGTATGCATGCATGTAGG + Intronic
1045897421 8:107236428-107236450 CAGTGTGTATGGGTGCATGAAGG + Intergenic
1046200607 8:110922965-110922987 CTGTGTGTGTGTTTGTGTGTAGG - Intergenic
1046328166 8:112677247-112677269 CTGTGTGTGTGTAAGCATGGGGG + Intronic
1046493435 8:114983166-114983188 TTGTGTGTGTGGGTGTGTGTGGG + Intergenic
1046530715 8:115441911-115441933 GTGTGTGTGTGTGTGCAGGTTGG + Intronic
1046792166 8:118333895-118333917 GTGTGTGTGTGTGTGCACGTTGG + Intronic
1046792181 8:118333975-118333997 CTGTGTGTGTGTGTGTGTGTGGG + Intronic
1046835701 8:118798909-118798931 CTATGTGTGTCTCTGCATGTGGG + Intergenic
1046884723 8:119353134-119353156 TTGTGTGTGTGCATGCATGTGGG + Intergenic
1047072667 8:121364207-121364229 GTGTGTGTGTGTGTGTATGTAGG - Intergenic
1047230856 8:122996639-122996661 ATGTGTGTGTGGAGGGCTGTGGG - Intergenic
1047415964 8:124664584-124664606 CTGTGAGTGTGTATGCTTTTAGG - Intronic
1047544957 8:125806848-125806870 CTCTGTGTGTGCATGTTTGTGGG + Intergenic
1047677148 8:127214781-127214803 GTGTGTGTGTGTGTGTATGTGGG + Intergenic
1048122668 8:131599284-131599306 CTGTGTCTGTGGCTACATGTGGG - Intergenic
1048383972 8:133893932-133893954 CTGTGTGTGTGTGTGCTTGTGGG - Intergenic
1048493724 8:134918353-134918375 CTGTGTGTGTGCATGCAACACGG + Intergenic
1048704427 8:137135642-137135664 GTGTGTGTGTGTATGCACATGGG + Intergenic
1048874959 8:138829306-138829328 GTGTGTCTGTGGATGCAGGTGGG - Intronic
1048878700 8:138856327-138856349 ATTTGTGTGTGAATGCATTTGGG + Intronic
1048880770 8:138870927-138870949 TTGTGTGTGTGGGTGTGTGTAGG + Intronic
1049272226 8:141702053-141702075 GAGTGTGAGTGGATGCGTGTGGG + Intergenic
1049305598 8:141901983-141902005 TTGTGTGTGTGTGAGCATGTTGG + Intergenic
1049610905 8:143554725-143554747 AGGTGTGTGTGTATGCACGTGGG - Intronic
1050081272 9:1918309-1918331 GTGTGTGTGTGTCTGTATGTTGG - Intergenic
1050176456 9:2874020-2874042 GTGTGTGTGTGTGTGCACGTGGG - Intergenic
1050375121 9:4963393-4963415 CATTGTTTGTGGATGGATGTCGG + Intergenic
1050428349 9:5535600-5535622 GTGTGTGTGTGTGTGCGTGTTGG + Intronic
1050495422 9:6236008-6236030 GTGTGTGTGTGTATGGGTGTGGG - Intronic
1052316367 9:27119889-27119911 GCGTGTGTGTGTGTGCATGTGGG + Intronic
1052662387 9:31450683-31450705 ATGTATATGTGTATGCATGTAGG - Intergenic
1052820684 9:33135929-33135951 GTGTGTGTATGCATGCATGTTGG + Intronic
1053080174 9:35169210-35169232 CTGTGCGTGTTGACGCATGCCGG + Intronic
1053271605 9:36753498-36753520 CTGTGCGTGTGCAGGCATGTGGG + Intergenic
1053386297 9:37692928-37692950 GTGTGTGTGTAGGTACATGTTGG - Intronic
1053547729 9:39041489-39041511 CTGTGTGTGTGTATGTGTGTAGG - Intergenic
1053671993 9:40375670-40375692 CTGTGTGTGTGTGTGTGTGTGGG + Intergenic
1054512630 9:66000640-66000662 CTGTGTGTGTGTGTGTGTGTGGG - Intergenic
1054841044 9:69740205-69740227 GTGTGTGTATGTATGTATGTAGG + Intronic
1055427824 9:76214283-76214305 GTGTGTGTGTGAGTGAATGTGGG - Intronic
1055580287 9:77701480-77701502 GTGTGTGTGTGTATGTGTGTGGG + Intergenic
1055801626 9:80042910-80042932 GTGTGTGTGTGTGTGCGTGTAGG - Intergenic
1055828686 9:80356732-80356754 CTGTGTGTTTGTATGTGTGTTGG - Intergenic
1055850167 9:80617876-80617898 GTGTGTGTGTGTGTGCATGGGGG + Intergenic
1055916572 9:81408196-81408218 ATGTGTGTGTGTATGTGTGTGGG - Intergenic
1056045508 9:82711462-82711484 CTATGTCTGTGGATTAATGTTGG + Intergenic
1056456438 9:86765565-86765587 CTGAGTGTGTGGATGTGTCTGGG + Intergenic
1056768298 9:89458845-89458867 GTGTGTATGTGTATCCATGTGGG - Intronic
1056778969 9:89535105-89535127 CTGTGTGTGTGTATGTGTGTAGG + Intergenic
1056778971 9:89535129-89535151 CTGTGTGTGTGTATGTGTGTAGG + Intergenic
1056778980 9:89535249-89535271 CTGTGTGTGTGTATGTGTATAGG + Intergenic
1056779663 9:89539692-89539714 GTGTGTGTGTGCATGTCTGTGGG + Intergenic
1056837030 9:89963583-89963605 ATATGTTTGTGGATACATGTGGG - Intergenic
1057385703 9:94604419-94604441 CTATGTGTTTGGATGTATTTGGG - Intronic
1057526285 9:95805209-95805231 ATGTGTGTGTGCATGCATGTTGG + Intergenic
1057571348 9:96206499-96206521 GGATGTGTGTGGGTGCATGTGGG - Intergenic
1057571355 9:96206539-96206561 GGGTGTGTATAGATGCATGTGGG - Intergenic
1057581189 9:96289221-96289243 ATGTGTGTGTGTATGGAAGTGGG + Intronic
1057586122 9:96330304-96330326 CTGTGTGTGTGTATATGTGTGGG - Intronic
1058006256 9:99918673-99918695 GTGTTTGTGTGTATGCATGTGGG + Intronic
1058057725 9:100465900-100465922 GTGTGTGTATGCATGCATATTGG - Intronic
1058160715 9:101567757-101567779 CTGTGTGTATGTGTGCATGTGGG - Intergenic
1058451797 9:105103861-105103883 GTGTGTGTGTGTGTGTATGTTGG - Intergenic
1058609819 9:106763342-106763364 GTGTGTGTGTGTATGTGTGTTGG - Intergenic
1058634128 9:107019891-107019913 GTATGTGTGTGGAGGGATGTTGG - Intergenic
1058681528 9:107444548-107444570 CAGGGTGTGTGTATGCATGTGGG + Intergenic
1059541629 9:115136261-115136283 GTGTGTGTGTGTGTGTATGTTGG + Intergenic
1059945262 9:119403094-119403116 TTGTGTGTGTGTGTGCCTGTTGG + Intergenic
1060470147 9:123941911-123941933 CTGTGTGTGTGTGTGTGTGTGGG - Intergenic
1060811180 9:126612415-126612437 CTGTGTGTGTCTGTGCGTGTCGG - Intergenic
1060942204 9:127549321-127549343 GTGTGAGTGTGCATGCGTGTGGG - Intronic
1061209963 9:129185667-129185689 GTGTGTGTGTGCATGTGTGTGGG - Intergenic
1062106980 9:134760813-134760835 GTGCATGTGTGTATGCATGTGGG - Intronic
1062116665 9:134813244-134813266 ATGTGTGTGTGCCTGCATGCTGG + Intronic
1062187482 9:135225643-135225665 GTGTGTGTGTGAGTGCACGTGGG - Intergenic
1062187489 9:135225715-135225737 GTGTGTGTGTGAGTGTATGTGGG - Intergenic
1062187511 9:135226269-135226291 GTGCGTGTGTGAATGTATGTGGG - Intergenic
1062288505 9:135784392-135784414 CTGTGTGTGTGTATGCATGAGGG + Intronic
1062451307 9:136616877-136616899 ATGAGTGTGTGGAAGGATGTCGG + Intergenic
1062470673 9:136702404-136702426 CTGTGTGTGTGTGTGCACATGGG - Intergenic
1203607014 Un_KI270748v1:67730-67752 ATGTGTGTGTCTACGCATGTGGG - Intergenic
1203629783 Un_KI270750v1:61841-61863 GGGTGTGTGTGGATGTGTGTTGG + Intergenic
1185589824 X:1268631-1268653 GTGTGTGTGTAGATGTGTGTGGG + Intergenic
1185701497 X:2234235-2234257 CTGTGTGCATGGATGCAGGCAGG - Intronic
1185769013 X:2750669-2750691 GTGTGTGTGTGTGTGCATATGGG - Intergenic
1185842830 X:3408891-3408913 GTGTGTGTGTGTATGGGTGTGGG - Intergenic
1186037210 X:5437375-5437397 GTGTGTGTGTGTGTGCGTGTAGG - Intergenic
1186038451 X:5449565-5449587 CTGTGTGTGGGGAGGGAGGTGGG - Intergenic
1186050546 X:5589841-5589863 GTGTGTGTGTGTGTGCATTTGGG - Intergenic
1186088513 X:6018198-6018220 ATGTGGGTGTGGGTGCATATGGG - Intronic
1186585082 X:10864911-10864933 GTGTGTGTGCGCATGCATGTTGG + Intergenic
1186700605 X:12086103-12086125 GTGTGTGTGTGAATGCTTTTGGG + Intergenic
1186878519 X:13840814-13840836 ATGTGTGTGTGTGTGTATGTAGG + Intronic
1186940107 X:14497440-14497462 CTCAGTGTGAGGATCCATGTGGG + Intergenic
1187484413 X:19688618-19688640 GTGTGTGTGTGGGTGGGTGTGGG - Intronic
1187484419 X:19688640-19688662 TTGTGTGTGTGCGTGTATGTGGG - Intronic
1187726553 X:22209198-22209220 GTGTGTGTGTGTGTGCATTTTGG + Intronic
1188382283 X:29509680-29509702 GTGTGTGTGTGTGTGCGTGTGGG - Intronic
1188686651 X:33077575-33077597 CTGTTTGAGTGGATTCATGCAGG + Intronic
1188722277 X:33537739-33537761 CTGTTTGTGGTGATGCAAGTAGG + Intergenic
1188802255 X:34547146-34547168 GTGTGTGTGTGTGTGCATCTTGG + Intergenic
1189067138 X:37822172-37822194 ATGTGTGTGTGCATGCATGGGGG + Intronic
1190212974 X:48461986-48462008 AGGTGTGTGTGCAGGCATGTAGG - Exonic
1190441458 X:50478910-50478932 CTGTGTTTGTGCATGCACGGGGG - Intergenic
1190786914 X:53660363-53660385 TTGTGTGTGTGCATTCATATTGG - Intronic
1191111792 X:56809638-56809660 CTGTGTGTGTCTTTGCATGTGGG + Intergenic
1191180217 X:57554229-57554251 TTGTGTGTGTGTATGTGTGTGGG - Intergenic
1191955554 X:66639180-66639202 CTGTGAGTGTGTATGCAGGCTGG - Intronic
1192174308 X:68876243-68876265 CTGTGTGTGCACATGCTTGTAGG - Intergenic
1192185504 X:68944265-68944287 CTGTGTGTGGGGATGAGTGCAGG + Intergenic
1192361991 X:70445962-70445984 ATATGTGTGTGTATGTATGTTGG + Intronic
1192582476 X:72296110-72296132 GTGTGTGTGTGTATGACTGTTGG + Intronic
1193436780 X:81483296-81483318 CTTTGTTTTTGTATGCATGTTGG - Intergenic
1193461929 X:81800781-81800803 TTGTGTGTGTGCATGTGTGTCGG + Intergenic
1193678980 X:84494138-84494160 TTGTATGGATGGATGCATGTGGG - Intronic
1194168036 X:90546098-90546120 GTGTGTGTGTGTTTGTATGTAGG - Intergenic
1194284263 X:91990368-91990390 ATGTGTTTGTGGTTGCTTGTTGG + Intronic
1194287023 X:92022278-92022300 CTATGTGTGTCTTTGCATGTGGG - Intronic
1194786695 X:98093719-98093741 GTGTGTGTGTGTGTGTATGTGGG - Intergenic
1194894828 X:99427389-99427411 GTGTGTGTGTTGTTGCAGGTTGG - Intergenic
1195320911 X:103721419-103721441 ATATGTGTGTGCATGTATGTGGG - Intronic
1195524266 X:105868430-105868452 ATATGTGTATGCATGCATGTAGG - Intronic
1195563671 X:106316190-106316212 GTGTGTGTGTGCATGCATTTAGG - Intergenic
1195985807 X:110628575-110628597 CTGTGTGTGTCTTTGCATGTGGG - Intergenic
1196110825 X:111945500-111945522 GTGTGTGTGTCTATGTATGTCGG - Intronic
1196172447 X:112604625-112604647 ATGTGTGTGTGTATGTGTGTTGG - Intergenic
1196409468 X:115400705-115400727 GTGTGTGTGTGTGTGTATGTGGG + Intergenic
1196819298 X:119690332-119690354 GTGTGTATGTGTATGTATGTGGG - Intronic
1196874788 X:120147451-120147473 CTGTGTATGTGTGTGAATGTGGG + Intergenic
1197111131 X:122776148-122776170 CTGTGTGGTTACATGCATGTTGG + Intergenic
1197501649 X:127249825-127249847 GTGTGTGTGTGTGTTCATGTGGG + Intergenic
1197585523 X:128342672-128342694 GTGTGTGTGTGTGTGTATGTTGG - Intergenic
1198080831 X:133237672-133237694 CTGTGTGTGTGTGTGTGTGTTGG - Intergenic
1198083731 X:133263658-133263680 GTGTGTGTGTGTATGTGTGTAGG - Intergenic
1198342001 X:135723773-135723795 CTGTGTGTGTGTGTGTGTGTTGG + Intergenic
1198345994 X:135759598-135759620 CTGTGTGTGTGTGTGTGTGTTGG - Intergenic
1198483417 X:137062235-137062257 GTGTGTGTGTGTATGCACGCAGG - Intergenic
1198782368 X:140251142-140251164 GTGTGTGTGTGTGTGCACGTGGG - Intergenic
1199267276 X:145843376-145843398 CTGTGTGTGAGGCTGCCTGGGGG + Intergenic
1199387018 X:147234809-147234831 GTGGGTGGGTGGATGGATGTGGG - Intergenic
1199506162 X:148563491-148563513 CTGTGTGTGTGTGTGCATGCTGG + Intronic
1199868276 X:151873896-151873918 GTGTGCGTGTGCATGCATCTGGG + Intergenic
1199881594 X:151977714-151977736 GTGTGTGTGTGCATGTGTGTGGG + Intergenic
1199972721 X:152872664-152872686 GTGTGTGTGTGGGTGGGTGTGGG + Intergenic
1200514287 Y:4123894-4123916 GTGTGTGTGTGTTTGTATGTAGG - Intergenic
1200601830 Y:5214927-5214949 ATGTGTTTGTGGTTGCTTGTTGG + Intronic
1200928575 Y:8676489-8676511 CTGTATGTGTGTATGCATGTGGG - Intergenic
1201567112 Y:15376892-15376914 GTGTGTGTGTGTGTGCATGCAGG - Intergenic
1201633035 Y:16091256-16091278 CTGTGTGTGGGGAGGGAGGTGGG + Intergenic
1201636981 Y:16134213-16134235 GTGTGTGTGTGTGTGCATGTGGG + Intergenic
1201645809 Y:16230323-16230345 CTATGTGTGTGGATGGATGCTGG + Intergenic
1201657004 Y:16354993-16355015 CTATGTGTGTGGATGGATGCTGG - Intergenic
1202116210 Y:21470918-21470940 CTGTGTGTGTTGGTGTGTGTGGG + Intergenic