ID: 1034988784

View in Genome Browser
Species Human (GRCh38)
Location 7:155534530-155534552
Sequence CCGGTCAGTCCCACATGCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034988784_1034988791 -2 Left 1034988784 7:155534530-155534552 CCTTAGCATGTGGGACTGACCGG No data
Right 1034988791 7:155534551-155534573 GGGAAGGCGGATCAGCTGCAGGG No data
1034988784_1034988792 -1 Left 1034988784 7:155534530-155534552 CCTTAGCATGTGGGACTGACCGG No data
Right 1034988792 7:155534552-155534574 GGAAGGCGGATCAGCTGCAGGGG No data
1034988784_1034988790 -3 Left 1034988784 7:155534530-155534552 CCTTAGCATGTGGGACTGACCGG No data
Right 1034988790 7:155534550-155534572 CGGGAAGGCGGATCAGCTGCAGG No data
1034988784_1034988793 5 Left 1034988784 7:155534530-155534552 CCTTAGCATGTGGGACTGACCGG No data
Right 1034988793 7:155534558-155534580 CGGATCAGCTGCAGGGGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034988784 Original CRISPR CCGGTCAGTCCCACATGCTA AGG (reversed) Intergenic
No off target data available for this crispr