ID: 1034993401

View in Genome Browser
Species Human (GRCh38)
Location 7:155562289-155562311
Sequence CCTGAAGTCCAGCTCCACCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034993401_1034993409 0 Left 1034993401 7:155562289-155562311 CCCGGGTGGAGCTGGACTTCAGG No data
Right 1034993409 7:155562312-155562334 GGAGGAGGTGACGTCCACGTGGG No data
1034993401_1034993410 1 Left 1034993401 7:155562289-155562311 CCCGGGTGGAGCTGGACTTCAGG No data
Right 1034993410 7:155562313-155562335 GAGGAGGTGACGTCCACGTGGGG No data
1034993401_1034993408 -1 Left 1034993401 7:155562289-155562311 CCCGGGTGGAGCTGGACTTCAGG No data
Right 1034993408 7:155562311-155562333 GGGAGGAGGTGACGTCCACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034993401 Original CRISPR CCTGAAGTCCAGCTCCACCC GGG (reversed) Intergenic
No off target data available for this crispr