ID: 1034997571

View in Genome Browser
Species Human (GRCh38)
Location 7:155587720-155587742
Sequence CCGTGGCGCTCCCTGGCTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034997562_1034997571 4 Left 1034997562 7:155587693-155587715 CCTCCTGCCCCTGGGGTGGCTGT No data
Right 1034997571 7:155587720-155587742 CCGTGGCGCTCCCTGGCTTGTGG No data
1034997561_1034997571 7 Left 1034997561 7:155587690-155587712 CCTCCTCCTGCCCCTGGGGTGGC No data
Right 1034997571 7:155587720-155587742 CCGTGGCGCTCCCTGGCTTGTGG No data
1034997555_1034997571 28 Left 1034997555 7:155587669-155587691 CCTGGGGAGGATCTGTCCAGGCC No data
Right 1034997571 7:155587720-155587742 CCGTGGCGCTCCCTGGCTTGTGG No data
1034997564_1034997571 -3 Left 1034997564 7:155587700-155587722 CCCCTGGGGTGGCTGTCCAGCCG No data
Right 1034997571 7:155587720-155587742 CCGTGGCGCTCCCTGGCTTGTGG No data
1034997563_1034997571 1 Left 1034997563 7:155587696-155587718 CCTGCCCCTGGGGTGGCTGTCCA No data
Right 1034997571 7:155587720-155587742 CCGTGGCGCTCCCTGGCTTGTGG No data
1034997565_1034997571 -4 Left 1034997565 7:155587701-155587723 CCCTGGGGTGGCTGTCCAGCCGT No data
Right 1034997571 7:155587720-155587742 CCGTGGCGCTCCCTGGCTTGTGG No data
1034997557_1034997571 12 Left 1034997557 7:155587685-155587707 CCAGGCCTCCTCCTGCCCCTGGG No data
Right 1034997571 7:155587720-155587742 CCGTGGCGCTCCCTGGCTTGTGG No data
1034997566_1034997571 -5 Left 1034997566 7:155587702-155587724 CCTGGGGTGGCTGTCCAGCCGTG No data
Right 1034997571 7:155587720-155587742 CCGTGGCGCTCCCTGGCTTGTGG No data
1034997554_1034997571 29 Left 1034997554 7:155587668-155587690 CCCTGGGGAGGATCTGTCCAGGC No data
Right 1034997571 7:155587720-155587742 CCGTGGCGCTCCCTGGCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034997571 Original CRISPR CCGTGGCGCTCCCTGGCTTG TGG Intergenic
No off target data available for this crispr