ID: 1034999208

View in Genome Browser
Species Human (GRCh38)
Location 7:155598167-155598189
Sequence TCTTAGATGCAAATTTTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034999208_1034999209 15 Left 1034999208 7:155598167-155598189 CCATGCAAAATTTGCATCTAAGA No data
Right 1034999209 7:155598205-155598227 AAGATCTTGCATTTCAAAGTAGG No data
1034999208_1034999210 28 Left 1034999208 7:155598167-155598189 CCATGCAAAATTTGCATCTAAGA No data
Right 1034999210 7:155598218-155598240 TCAAAGTAGGTTTAAGATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034999208 Original CRISPR TCTTAGATGCAAATTTTGCA TGG (reversed) Intergenic
No off target data available for this crispr