ID: 1034999691

View in Genome Browser
Species Human (GRCh38)
Location 7:155603021-155603043
Sequence CACGCTGGTGCTCCACACTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034999682_1034999691 14 Left 1034999682 7:155602984-155603006 CCAAGGCTCAAGTCTGGAAGCAG No data
Right 1034999691 7:155603021-155603043 CACGCTGGTGCTCCACACTCGGG No data
1034999679_1034999691 17 Left 1034999679 7:155602981-155603003 CCCCCAAGGCTCAAGTCTGGAAG No data
Right 1034999691 7:155603021-155603043 CACGCTGGTGCTCCACACTCGGG No data
1034999681_1034999691 15 Left 1034999681 7:155602983-155603005 CCCAAGGCTCAAGTCTGGAAGCA No data
Right 1034999691 7:155603021-155603043 CACGCTGGTGCTCCACACTCGGG No data
1034999677_1034999691 30 Left 1034999677 7:155602968-155602990 CCTGGGAGAGTTGCCCCCAAGGC No data
Right 1034999691 7:155603021-155603043 CACGCTGGTGCTCCACACTCGGG No data
1034999686_1034999691 -10 Left 1034999686 7:155603008-155603030 CCTCCAGGATGCCCACGCTGGTG No data
Right 1034999691 7:155603021-155603043 CACGCTGGTGCTCCACACTCGGG No data
1034999680_1034999691 16 Left 1034999680 7:155602982-155603004 CCCCAAGGCTCAAGTCTGGAAGC No data
Right 1034999691 7:155603021-155603043 CACGCTGGTGCTCCACACTCGGG No data
1034999685_1034999691 -9 Left 1034999685 7:155603007-155603029 CCCTCCAGGATGCCCACGCTGGT No data
Right 1034999691 7:155603021-155603043 CACGCTGGTGCTCCACACTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034999691 Original CRISPR CACGCTGGTGCTCCACACTC GGG Intergenic
No off target data available for this crispr