ID: 1034999718

View in Genome Browser
Species Human (GRCh38)
Location 7:155603163-155603185
Sequence GACATGTATTTCCCTCCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034999718_1034999724 11 Left 1034999718 7:155603163-155603185 CCTGGGGGAGGGAAATACATGTC No data
Right 1034999724 7:155603197-155603219 CACTCTCCAGAGACCACCCCTGG No data
1034999718_1034999726 19 Left 1034999718 7:155603163-155603185 CCTGGGGGAGGGAAATACATGTC No data
Right 1034999726 7:155603205-155603227 AGAGACCACCCCTGGTGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034999718 Original CRISPR GACATGTATTTCCCTCCCCC AGG (reversed) Intergenic
No off target data available for this crispr