ID: 1035003540

View in Genome Browser
Species Human (GRCh38)
Location 7:155637228-155637250
Sequence CTTATCTCACTTATGGAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 199}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035003540_1035003544 9 Left 1035003540 7:155637228-155637250 CCTTTTTCCATAAGTGAGATAAG 0: 1
1: 0
2: 1
3: 16
4: 199
Right 1035003544 7:155637260-155637282 TACCAATGGAGTTTCTCGAGTGG 0: 1
1: 0
2: 0
3: 2
4: 31
1035003540_1035003543 -5 Left 1035003540 7:155637228-155637250 CCTTTTTCCATAAGTGAGATAAG 0: 1
1: 0
2: 1
3: 16
4: 199
Right 1035003543 7:155637246-155637268 ATAAGAGAGGTGTGTACCAATGG 0: 1
1: 0
2: 1
3: 5
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035003540 Original CRISPR CTTATCTCACTTATGGAAAA AGG (reversed) Intronic
902896068 1:19480939-19480961 CTTTGCACACTTTTGGAAAATGG + Intronic
903001924 1:20272501-20272523 GGTCTCTCTCTTATGGAAAAAGG + Intergenic
903640106 1:24853519-24853541 CTTTTCTGCCTTAAGGAAAATGG + Intergenic
903876171 1:26474561-26474583 CTTCTCTCCCTTCTGAAAAAGGG - Exonic
906476564 1:46173205-46173227 GTTATCTCACCTATGGGAGAAGG + Intronic
907088309 1:51700009-51700031 TTTTTCTCACTTTTGGAAAACGG - Intronic
908868576 1:68581186-68581208 TGTATCTCAGTTAAGGAAAATGG - Intergenic
910509458 1:87987470-87987492 GTTATGTTACTAATGGAAAAGGG + Intergenic
910601563 1:89038212-89038234 CTGATGTCACTTATGTGAAATGG + Intergenic
911323718 1:96444808-96444830 CTTCGTTCACTTTTGGAAAATGG + Intergenic
915132045 1:153702193-153702215 CTCATTTTATTTATGGAAAAGGG + Intergenic
915137775 1:153745761-153745783 CTTCTGCCACTTATTGAAAAAGG - Intronic
915799657 1:158776703-158776725 TTTATCTCCCTTCTGGAAGATGG + Exonic
920758889 1:208762551-208762573 CTTCTCTCTCTTGTGGAAATAGG + Intergenic
921136758 1:212267784-212267806 CTTACCTCATTTTTGGACAACGG - Intergenic
923862005 1:237900536-237900558 CTAGTCTCACTTATAGGAAAGGG - Intergenic
923953334 1:238986446-238986468 TATATCTCACTTAAGGAAAAGGG - Intergenic
924140581 1:241018853-241018875 CATATCTCACCTAAAGAAAAAGG - Intronic
1066283495 10:33941274-33941296 CTTAGCTCCCATATGTAAAAGGG + Intergenic
1068799778 10:61127039-61127061 CTTTTCCCACTTATGGTAATTGG - Intergenic
1073233632 10:101994437-101994459 CTTTTCTCTCTTAAGAAAAATGG - Intronic
1074027517 10:109651897-109651919 CTTAACTCTCTTATGGGGAATGG - Intergenic
1074261216 10:111855327-111855349 CTTGTCTCAATTGTGCAAAATGG - Intergenic
1074692889 10:116022555-116022577 CTCTTATCACTGATGGAAAATGG - Intergenic
1079598291 11:22280674-22280696 CGTATCTAACTTATACAAAAAGG - Exonic
1081464873 11:43307051-43307073 CTCATCTCAGTTAAGGAACATGG + Intergenic
1083247253 11:61438619-61438641 TTTGTCTCACTTAAGCAAAAAGG + Intronic
1083249579 11:61457153-61457175 CTCATCTCTCTGATGGACAATGG + Intronic
1086788077 11:90997021-90997043 CCTATCTCAAATATTGAAAATGG + Intergenic
1087329372 11:96760573-96760595 TTTTCCTCACTTATGAAAAAGGG + Intergenic
1094356396 12:29582649-29582671 CTAATATCACTTAAGGAAAGGGG - Intronic
1095192800 12:39277604-39277626 GTATTCTCACTTATGCAAAATGG + Intergenic
1095272179 12:40232154-40232176 CTTATCTCACTTGTAAACAATGG - Intronic
1095643605 12:44514676-44514698 CGTATATCCCTTGTGGAAAAAGG + Intronic
1096825106 12:54269730-54269752 CCTATCTCTATTAAGGAAAAGGG - Intronic
1096991981 12:55812054-55812076 CGTATCTCACTAAGGGTAAAAGG + Intronic
1097061843 12:56290795-56290817 GTTATCTTAATTATGGAAATGGG - Intronic
1097480755 12:60122659-60122681 CATATCTCACATATGATAAAGGG - Intergenic
1097786803 12:63769376-63769398 TTTATCCCACTCATGAAAAATGG + Intergenic
1099123384 12:78720707-78720729 CTTAAGTCCCTTATAGAAAATGG - Intergenic
1100794579 12:98167213-98167235 ATTAACTAACTTAAGGAAAAAGG + Intergenic
1101370866 12:104129026-104129048 CTTATATCACTTATGGAAGATGG - Intronic
1103250053 12:119491844-119491866 CTTTTCTCAGTTTTGGAGAATGG - Intronic
1103748900 12:123145503-123145525 CTTATCTCTATTGTGGAAAGGGG - Intronic
1103908197 12:124338093-124338115 ATTATTTCAATTATGAAAAATGG - Intronic
1104289112 12:127452566-127452588 CTTAGCAAATTTATGGAAAATGG - Intergenic
1109159218 13:58950886-58950908 CTTATCAGATGTATGGAAAAGGG - Intergenic
1109806178 13:67446714-67446736 CATATTTCACTTATGGAAGAAGG - Intergenic
1110416977 13:75263645-75263667 CCTATCTGACTTCTTGAAAATGG - Intergenic
1110829897 13:80018916-80018938 CTTGTGTAACTTCTGGAAAATGG + Intergenic
1113024694 13:105927893-105927915 CTTCTCTCAAATATGAAAAAGGG - Intergenic
1116628391 14:47297158-47297180 ATTATCTCACTTATTAAAAATGG + Intronic
1117156644 14:52948862-52948884 CTTTTCTAATTTATGGTAAATGG - Intronic
1122252682 14:100451058-100451080 CTTTTTTCACTCTTGGAAAATGG - Intronic
1127486762 15:59425419-59425441 ATTATCTGAGTTATGGAAAAAGG + Intronic
1127598697 15:60513176-60513198 CTTATCTGAGTTGTGGAAACTGG - Intronic
1131039358 15:89248276-89248298 ATGAGATCACTTATGGAAAAAGG - Intronic
1131874966 15:96796137-96796159 ATTTTCTCACTTAGTGAAAAAGG - Intergenic
1134348170 16:13411181-13411203 ATTATCTCACTTAAGGAGGAAGG - Intergenic
1135792564 16:25410698-25410720 CCTCTCTCATTTATGGAAATCGG + Intergenic
1137580216 16:49629013-49629035 CTTCTCTTACTTCTGGAAAAGGG + Intronic
1137847707 16:51708324-51708346 CTTTTCTCCCTTCTGCAAAATGG - Intergenic
1139102243 16:63782660-63782682 CTTATCTGACTTATAAAAATAGG + Intergenic
1139128394 16:64109725-64109747 CTAATCTCATTCATGGAAATGGG - Intergenic
1140050644 16:71478296-71478318 CTGATCTCACTTTTGGAGAGAGG - Exonic
1140549875 16:75854355-75854377 CTTTTCTGGCTTATGCAAAAGGG - Intergenic
1142860798 17:2760062-2760084 CCAATCTCACTGATGAAAAATGG + Intergenic
1143694741 17:8604631-8604653 CTTATCATACTTACAGAAAATGG + Intronic
1148026354 17:44591620-44591642 CCCATCTCTCTGATGGAAAAAGG + Intergenic
1149549793 17:57531895-57531917 CCTTTCTCCCTTTTGGAAAAAGG - Intronic
1151013936 17:70532309-70532331 CTTAGCTTAATTCTGGAAAATGG - Intergenic
1153415037 18:4837109-4837131 ATTAGCTCAATTATGGAAGAAGG - Intergenic
1155079065 18:22389525-22389547 TTTTTCTCACCTATGGAGAATGG - Intergenic
1156209291 18:34921271-34921293 ATGATCTCATTTATGGATAATGG - Intergenic
1158179027 18:54691507-54691529 ATTATTTCACTTAGAGAAAAGGG + Intergenic
1162973475 19:14195201-14195223 CCTATCTCACCCATGGGAAACGG + Intronic
1164829970 19:31312830-31312852 CTTATCTCTCTTCTTTAAAAAGG - Intronic
1167485223 19:49758748-49758770 CTTTTGTCACTAATGCAAAAGGG - Intronic
925477765 2:4237431-4237453 CTTACCTGGCTTATGAAAAAAGG + Intergenic
926026781 2:9552193-9552215 ATTATCTCACAAATAGAAAATGG + Intronic
926269430 2:11354241-11354263 CCTTTCTCCCTTCTGGAAAAGGG - Intergenic
927244183 2:20943525-20943547 CTTATCGCAGTTATGGAGAGTGG - Intergenic
927998559 2:27504212-27504234 CTTATCTCACAAAAGGAAGATGG - Intronic
928045174 2:27924101-27924123 ATGATTCCACTTATGGAAAAAGG - Intronic
930957897 2:57226121-57226143 CTTAGCTCACTTAAGGTTAAAGG + Intergenic
934922178 2:98353568-98353590 CTGAAGTCACTTATGCAAAATGG + Intronic
934947728 2:98554188-98554210 CTTATCTCAGAAATGGAGAATGG - Intronic
938814850 2:134891362-134891384 ATTTTCTCATTTATTGAAAAAGG + Intronic
941331544 2:164183560-164183582 TATATCTCACTTGAGGAAAAGGG - Intergenic
943830683 2:192457750-192457772 CTTTTCTAATTTTTGGAAAAAGG + Intergenic
943843393 2:192608024-192608046 CTATTACCACTTATGGAAAAGGG - Intergenic
944443700 2:199768552-199768574 CTAATCTCAACTATGGGAAAAGG - Intronic
947346564 2:229197171-229197193 CATTTCTCAGTTATGGAAAGTGG - Intronic
1168938627 20:1690188-1690210 CATATCTAACTTTTGGAACACGG - Intergenic
1169238784 20:3956422-3956444 CTAATATCACTAATGAAAAAGGG - Intronic
1170136578 20:13080615-13080637 CTTTTGTCAGTTAGGGAAAAAGG - Intronic
1170760671 20:19247939-19247961 CTTATCTCACTTATTTACAAAGG - Intronic
1176011375 20:62898169-62898191 CTTACCTCATTTATTGAAAGCGG - Intronic
1177477459 21:21642865-21642887 CTTATCTTAATTATTGATAATGG - Intergenic
1179361840 21:40716954-40716976 CTAATCTGACCTATGAAAAATGG + Intronic
1180743459 22:18070492-18070514 GTTTTCTCAGGTATGGAAAATGG + Intergenic
1180881939 22:19210344-19210366 CATATCAAACTTGTGGAAAACGG + Exonic
1184848312 22:47102534-47102556 CTCATATCATCTATGGAAAATGG - Intronic
950729405 3:14944333-14944355 CTTATCTCACCTCAGGAAAATGG + Intergenic
951280272 3:20739818-20739840 ATTATTTCAGATATGGAAAATGG - Intergenic
951753882 3:26067903-26067925 CTTGCCTCACTTAAGAAAAAAGG + Intergenic
952284356 3:31953921-31953943 CTGAACTCTCTGATGGAAAAAGG - Intronic
956236384 3:67076376-67076398 CTGATGTTACTTATGGAAATGGG + Intergenic
957512430 3:81206699-81206721 CTTATCTTGCTTTTGGAAAATGG - Intergenic
957594601 3:82246344-82246366 CTTAAGTCTCTTATGTAAAATGG + Intergenic
960195976 3:114768763-114768785 CTTCCCTCGCTTATGAAAAAAGG - Intronic
960830092 3:121836701-121836723 CATATCACACTTCCGGAAAATGG - Intronic
960957586 3:123044886-123044908 CTGATCTGACCTATGGAGAAGGG + Intergenic
963579393 3:147105805-147105827 CTTATCTGACTTTTGTATAAAGG + Intergenic
964237516 3:154550227-154550249 CTAGTCTAACTTATGGGAAAGGG - Intergenic
965054798 3:163698476-163698498 CTGATCTCTCTTATAAAAAACGG + Intergenic
966008877 3:175051672-175051694 CTAATTACACTTATGGAGAAGGG + Intronic
967273423 3:187749921-187749943 CTTTTCTCACTTATTTAAAATGG + Intergenic
967670438 3:192227477-192227499 TTTATCTGACTAATGGAATATGG + Intronic
970492315 4:16586812-16586834 CTTATATCAATTAAGGAAGAAGG - Intronic
971281766 4:25247264-25247286 AAAAGCTCACTTATGGAAAATGG - Intronic
973721839 4:53731756-53731778 CCTTTCTCACTTCTGGAAAGGGG - Intronic
973734189 4:53854172-53854194 CTCATGTCCCTTATGTAAAATGG - Intronic
974071649 4:57129472-57129494 CTTAACTGACTTGTGGAAGATGG + Intergenic
975651809 4:76600799-76600821 CTTATCTCACCTGTAGAAAAGGG + Intronic
975808166 4:78135098-78135120 CTTATCTCTCTTTTGTAATATGG - Intronic
976810680 4:89097617-89097639 AATCTTTCACTTATGGAAAATGG - Intronic
976840151 4:89423020-89423042 GTTTTCTCATTTATGGAAACAGG - Intergenic
977304584 4:95306692-95306714 TTTATCTTTCTTATGGCAAAAGG + Intronic
979641276 4:123014977-123014999 CTAAGCTTGCTTATGGAAAATGG + Intronic
980844961 4:138313164-138313186 CTCTTCTCACTCATGGTAAAAGG - Intergenic
981258905 4:142696218-142696240 CTTATCAGACACATGGAAAAGGG - Intronic
983310954 4:166060561-166060583 CATATTTTACTTATGGAAATGGG + Intronic
984546168 4:181106138-181106160 ATTATCTCACTTCTGGACCAGGG - Intergenic
985961855 5:3308639-3308661 CTTATCTAATTTCTAGAAAAAGG + Intergenic
986155442 5:5170235-5170257 ATTATCTCACTTCAGTAAAATGG - Intronic
986419353 5:7562899-7562921 CTCATTTCAGTTAAGGAAAATGG + Intronic
987053814 5:14171918-14171940 CTTTGCTCACTTTTGCAAAATGG - Intronic
987966105 5:24876658-24876680 CTAATGTCACTTATGGATACTGG + Intergenic
988168550 5:27625793-27625815 CTTAACTCACAAATTGAAAAAGG - Intergenic
988359828 5:30221736-30221758 CTTAACTCACTTATCTGAAATGG + Intergenic
988599001 5:32622119-32622141 ATTTTCTCATTTGTGGAAAAGGG + Intergenic
988918846 5:35922277-35922299 CTTATTTGACTTTTGGGAAAGGG + Intronic
992353348 5:75953700-75953722 TTTATCCCACTTAAGGAACAAGG - Intergenic
993643169 5:90430985-90431007 TTTATCTTACTTATGGAGGAAGG + Intergenic
994445325 5:99864796-99864818 CTTATCCCACTTAGGCAGAAAGG - Intergenic
995408695 5:111830960-111830982 CTTCCATCACTTATGGAACAGGG - Intronic
996261654 5:121478328-121478350 CTAATCTCAGCAATGGAAAAAGG + Intergenic
997188947 5:131912209-131912231 GTTACCTCATTTATGCAAAAGGG + Intronic
999576367 5:152982430-152982452 CATATCTAACTTAGGAAAAAAGG - Intergenic
1001824856 5:174736330-174736352 CCTAGCTCACTTCCGGAAAATGG - Intergenic
1003379663 6:5611936-5611958 CTTTTGTTCCTTATGGAAAATGG - Intronic
1003547460 6:7072026-7072048 GTTATCTCACTTGTGTAATAGGG + Intergenic
1003750896 6:9054599-9054621 GTTATCTCACTGGTGGAAGATGG + Intergenic
1006658160 6:35614717-35614739 ATTTTCTCACTTCTGGAGAATGG + Intronic
1006858057 6:37149806-37149828 TTTATATCACTTAAGGAAAAAGG - Intergenic
1008161890 6:48088124-48088146 CTTATAAAACTTATGGGAAATGG - Intergenic
1009211268 6:60865958-60865980 CTTAAGTCCCTTATGTAAAATGG + Intergenic
1009796523 6:68476098-68476120 CTAATGTCATTTATAGAAAAAGG - Intergenic
1010091012 6:71982021-71982043 ATTATCTCCCTTATTGATAATGG + Intronic
1012124070 6:95405144-95405166 CTCAACTCAATTCTGGAAAAAGG - Intergenic
1012695950 6:102383843-102383865 CCTGTCTCACTTATGGAGGATGG + Intergenic
1012856931 6:104513238-104513260 CTTATGTCACTTATGTCACAGGG + Intergenic
1013640394 6:112071166-112071188 GTTATCTCAATTTTAGAAAAGGG + Exonic
1014559956 6:122877768-122877790 CTTAGCTAACCTATGGAATAAGG + Intergenic
1015483155 6:133738211-133738233 CTTATTTCACTTAGTAAAAATGG - Intergenic
1015980870 6:138837242-138837264 GGTTTCTCACTTTTGGAAAAAGG - Intronic
1018780797 6:167063592-167063614 CTTATGTCACTAAAGGAAAAAGG + Intergenic
1019230959 6:170562365-170562387 TTTATCTCACATTTGGGAAAGGG + Intronic
1021794319 7:24238177-24238199 CTAATGTCGCTTATAGAAAAAGG - Intergenic
1023062366 7:36340895-36340917 CTAATCCCAATTTTGGAAAAAGG + Intronic
1026663111 7:72319622-72319644 CTTATTTCACTTACAGATAATGG - Intronic
1027997650 7:85446196-85446218 CTTATAGCAGTTATGGGAAATGG - Intergenic
1028752591 7:94396958-94396980 CTTATAACAATTATGGCAAAAGG + Intronic
1028871871 7:95779049-95779071 ATTATCTCAATTGGGGAAAAGGG + Intronic
1029860964 7:103571619-103571641 ATTATATTACTTATGGCAAAAGG + Intronic
1030986794 7:116251179-116251201 TTAAGGTCACTTATGGAAAAAGG - Intronic
1031204051 7:118731030-118731052 ATTATCACTCTTATGAAAAATGG + Intergenic
1031695088 7:124841564-124841586 CTTACCACACTTAGGGAGAAGGG + Intronic
1035003540 7:155637228-155637250 CTTATCTCACTTATGGAAAAAGG - Intronic
1035195106 7:157211958-157211980 CTTGACTCACTTGAGGAAAACGG + Intronic
1036443449 8:8801586-8801608 CTTAACTCACATATGAAGAATGG + Intronic
1037217997 8:16481521-16481543 CTTAGCCCAGTTCTGGAAAAAGG - Intronic
1038192881 8:25339857-25339879 CTCATCTCCCACATGGAAAATGG + Intronic
1038598373 8:28911756-28911778 CTCAAATCACTTATGTAAAATGG - Intronic
1038718756 8:30014511-30014533 CATATCTCAGAGATGGAAAATGG + Intergenic
1039191255 8:34978414-34978436 CATAGCTCAGTTATGGAAACTGG - Intergenic
1039229042 8:35422796-35422818 ATTTTCTCCCTTTTGGAAAAAGG + Intronic
1040649537 8:49432869-49432891 CTTATCTTTCTTAAGGAAGAAGG - Intergenic
1044048587 8:87470259-87470281 CTTATTTCTCTTCTGGAATATGG - Intronic
1044104394 8:88184827-88184849 CTAATTTCACTTATAGAAAAAGG + Intronic
1045687947 8:104730856-104730878 ATTTTCTCACTTAAAGAAAATGG - Intronic
1046229334 8:111332659-111332681 CTTATCTCAATGATGGGAATTGG + Intergenic
1048751328 8:137679675-137679697 CTTAGATCACTTATGCAACAGGG + Intergenic
1050422268 9:5477970-5477992 AATATGTCAATTATGGAAAATGG - Intergenic
1051478472 9:17534380-17534402 CTTAACTCTGTTATGGACAATGG - Intergenic
1053087275 9:35236455-35236477 CTAATCTCACTAAGGGAAAGAGG - Exonic
1055076425 9:72220153-72220175 CTTATTTCACTTATTGTAATGGG - Intronic
1055217377 9:73882901-73882923 TTTATCTCATCTTTGGAAAACGG + Intergenic
1055859678 9:80732969-80732991 CTTATCTCACCTATGGCAGCAGG - Intergenic
1056845745 9:90036662-90036684 CTTCTCTCACTTATGCTAAATGG + Intergenic
1060345479 9:122811980-122812002 CTGATCCCACTTATTAAAAAAGG - Intronic
1061248918 9:129415208-129415230 CCTTTCTCACATCTGGAAAAGGG - Intergenic
1062706170 9:137944705-137944727 TTTATATCAGTTATAGAAAAGGG + Intronic
1185820812 X:3202558-3202580 TCTATCTCCCTTATGTAAAAGGG + Intergenic
1187597605 X:20790955-20790977 CTTTTCTCACAAATGGAAAAGGG - Intergenic
1188788034 X:34373162-34373184 GTTACCTCACTTATGTAATAAGG - Intergenic
1189231108 X:39453141-39453163 ATTATCTCTGTAATGGAAAAGGG - Intergenic
1191224342 X:58026372-58026394 TTTGTCTCACTTAAGAAAAAAGG + Intergenic
1193082599 X:77420920-77420942 CTTATCTGAGTCATTGAAAAAGG + Intergenic
1193317003 X:80076489-80076511 CTTATCTCACTGATTGATAGTGG - Intergenic
1193750553 X:85337780-85337802 CTTAACTCACAAATGGGAAATGG - Intronic
1193851991 X:86548642-86548664 ATTCTCTAACTTAAGGAAAATGG - Intronic
1195626649 X:107010462-107010484 CTTGTCTCACCTATGCACAAAGG + Intergenic
1197196342 X:123705279-123705301 CTTTTTTCATTTATTGAAAATGG - Intronic
1199391945 X:147290541-147290563 TTTATATCACTTTTTGAAAAGGG - Intergenic
1200368302 X:155692008-155692030 CTTATTTCACTTAACAAAAAGGG - Intergenic