ID: 1035004813

View in Genome Browser
Species Human (GRCh38)
Location 7:155648207-155648229
Sequence AAATATACAAAAGTGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 609
Summary {0: 1, 1: 0, 2: 2, 3: 52, 4: 554}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035004813_1035004817 -8 Left 1035004813 7:155648207-155648229 CCCACCTCCACTTTTGTATATTT 0: 1
1: 0
2: 2
3: 52
4: 554
Right 1035004817 7:155648222-155648244 GTATATTTCAAACAAATCCTAGG No data
1035004813_1035004821 26 Left 1035004813 7:155648207-155648229 CCCACCTCCACTTTTGTATATTT 0: 1
1: 0
2: 2
3: 52
4: 554
Right 1035004821 7:155648256-155648278 TTAGAGCAAGATACACTGCTGGG 0: 1
1: 0
2: 1
3: 8
4: 115
1035004813_1035004820 25 Left 1035004813 7:155648207-155648229 CCCACCTCCACTTTTGTATATTT 0: 1
1: 0
2: 2
3: 52
4: 554
Right 1035004820 7:155648255-155648277 TTTAGAGCAAGATACACTGCTGG No data
1035004813_1035004818 -4 Left 1035004813 7:155648207-155648229 CCCACCTCCACTTTTGTATATTT 0: 1
1: 0
2: 2
3: 52
4: 554
Right 1035004818 7:155648226-155648248 ATTTCAAACAAATCCTAGGCTGG 0: 1
1: 0
2: 0
3: 20
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035004813 Original CRISPR AAATATACAAAAGTGGAGGT GGG (reversed) Intronic
901755162 1:11437009-11437031 AAATTTCCAGAAGTGGAGGTGGG + Intergenic
901803313 1:11721823-11721845 AAATATACAAAAATTAAGGCTGG + Exonic
901916688 1:12505701-12505723 AAATGCTCAAAAGTGGAGGAGGG + Intronic
902069860 1:13724976-13724998 AAACCTACAAGAGTGGAGGGAGG - Intronic
902605603 1:17567525-17567547 AAAAATACAAAAAAGGAGCTGGG - Intronic
902900260 1:19510177-19510199 AAAAATACAAAAATTGAGGATGG + Intergenic
902928126 1:19710907-19710929 ACATGTGCCAAAGTGGAGGTGGG + Intronic
903114105 1:21164067-21164089 AAAGAAACAAAATTGGAGCTGGG - Intronic
903842524 1:26253880-26253902 AAAAATACAAAAACTGAGGTGGG + Intronic
904511571 1:31014346-31014368 AAATAAAAAAAAGTCGAGGCTGG + Intronic
904653310 1:32023206-32023228 AAAAAAACAAAAGTGGGGGGTGG + Intronic
905072308 1:35237469-35237491 AAACAAACAAAACTGGAGGCAGG + Intergenic
905121943 1:35689068-35689090 AAGTTTCCAAAAGTGGAGCTTGG + Intergenic
905175511 1:36132886-36132908 AAAAATACAAAAATTGAGGCGGG + Intergenic
905551772 1:38847195-38847217 AAATATAGAAAAGTGAAAATAGG - Intronic
906168366 1:43704746-43704768 ATAAATACAAAAGTAGGGGTTGG - Exonic
906538489 1:46565911-46565933 AAATAGAGAAAAGGGGAGGGAGG - Intronic
906729891 1:48071996-48072018 AAATATAAAAAGGATGAGGTGGG - Intergenic
906773438 1:48506159-48506181 AAAAATACAAAAATTTAGGTGGG - Intergenic
908512574 1:64861084-64861106 AGAGGCACAAAAGTGGAGGTGGG + Intronic
909305275 1:74067263-74067285 AAACATACAAAAGTGGAAGAGGG + Intronic
909904267 1:81176318-81176340 AAAAATGCAAAAGTGGAGGCAGG - Intergenic
910048304 1:82944503-82944525 AAACAAACAAAACTGGAGGAAGG + Intergenic
910197658 1:84660604-84660626 AAAAATACAAAATTGGCCGTGGG + Intronic
910829066 1:91441794-91441816 AAAAAAAAAAAGGTGGAGGTGGG + Intergenic
910909660 1:92219636-92219658 AAATATTAAACAGTGGGGGTGGG - Intronic
911842063 1:102695251-102695273 AAAAATACAAAAGTTTAGCTGGG - Intergenic
912144683 1:106778832-106778854 AATCATAAGAAAGTGGAGGTAGG - Intergenic
912352300 1:109025756-109025778 AAATAAAAAAAAGTGGCGCTAGG + Intronic
912810017 1:112786999-112787021 AAAAATACAAAATTAGAGCTCGG + Intergenic
913135678 1:115886497-115886519 AAATACAAAAAAGTGGTGGTGGG + Intergenic
914866045 1:151430016-151430038 AAATGAACAGAAGTGGGGGTGGG + Intronic
914894541 1:151657324-151657346 AAAAATACAAAAATGAAGCTGGG - Intronic
915152288 1:153843569-153843591 AAATATAAAAAATTGAAGGCTGG - Intronic
915485025 1:156214208-156214230 AATTATATAAAAGTGAAGGCCGG - Intronic
915578795 1:156800750-156800772 AAAAAAAAAAAAGTGGTGGTGGG - Exonic
915795692 1:158731327-158731349 AAATAAACAAAACTAGGGGTTGG + Intergenic
916097042 1:161360564-161360586 AAAAAAAAAAAAGTGGGGGTGGG + Intronic
916416727 1:164599360-164599382 AAAGAAACAAAAATGGAGGGGGG - Intronic
918565666 1:185928141-185928163 CAATATACAAATTTGAAGGTAGG - Intronic
918576996 1:186073431-186073453 AAATGTAGAAATGTAGAGGTGGG + Intronic
918976113 1:191488628-191488650 CAATATACAATTGTGGAGCTGGG + Intergenic
919092430 1:192991629-192991651 AAAAATACAAAAATGTAGCTGGG + Intergenic
919185160 1:194136769-194136791 AAATATAAAAAAGTATATGTTGG - Intergenic
922408963 1:225350448-225350470 AAATAAACAAAACTAAAGGTTGG + Intronic
922538157 1:226398533-226398555 AAAAAAAAAAAAGTGGGGGTAGG + Intronic
923599971 1:235394233-235394255 AAATATACAAAAAAGTAGCTGGG - Intronic
924222483 1:241892636-241892658 AAAAATACAAAAATGAAGCTGGG - Intronic
924423424 1:243930523-243930545 CAAGATTCAAAGGTGGAGGTTGG - Intergenic
1063352426 10:5367896-5367918 AAATAAACAAATGGGGTGGTGGG + Intronic
1063828943 10:9930674-9930696 AAAAATACATTAGTGGACGTGGG + Intergenic
1063950196 10:11214909-11214931 AAACATACAGAAGGGGAGATGGG - Intronic
1064065237 10:12175772-12175794 AAAAATACAAAAAATGAGGTGGG + Intronic
1064835287 10:19520921-19520943 AAATATACCAAAGTAAAGGAAGG - Intronic
1065111278 10:22442473-22442495 AAAGGTACAAAATAGGAGGTAGG + Intronic
1065602041 10:27378884-27378906 AAATAAATAAAAGTTGAGGCTGG - Intergenic
1066214727 10:33275055-33275077 AAATATACAATGGTGGAGCTAGG + Intronic
1067052767 10:43032225-43032247 ATATAGACAAAATTGGGGGTGGG + Intergenic
1067846189 10:49723594-49723616 AAATATACAGAAAAGGAGGCTGG - Intergenic
1068722174 10:60257733-60257755 AAATATACAGACGTGAAGGGCGG - Intronic
1070412177 10:76151761-76151783 AAATAAACAAAAGTTAAGTTAGG - Intronic
1071366132 10:84902283-84902305 AATAATAATAAAGTGGAGGTAGG + Intergenic
1071612698 10:87045967-87045989 AAGAATGCAAAAGTGGAGCTGGG - Intergenic
1071948642 10:90677504-90677526 AAAAATACAAAAGTTTAGCTGGG - Intergenic
1072542821 10:96411283-96411305 AAAAAAAAAAAAGTGGAAGTAGG + Intronic
1072602599 10:96942956-96942978 TAAGATACAAGAGTGGAGGTAGG + Intronic
1073194755 10:101681041-101681063 AAATTTATAAAGGTAGAGGTGGG + Intronic
1073835660 10:107438086-107438108 AAACTCACAAAAGTGGAGGGTGG + Intergenic
1073866453 10:107809729-107809751 AAAAAAATAAAAGTGGGGGTGGG + Intergenic
1074014580 10:109521168-109521190 AAATGTACAAATATGGTGGTAGG - Intergenic
1074021395 10:109588236-109588258 AAATATACAATAGTTGAGTTGGG + Intergenic
1074418660 10:113289704-113289726 AAATACACAAAAGAGTAAGTGGG - Intergenic
1075205350 10:120443116-120443138 AAATCTACAAATGTGGAGTAGGG + Intergenic
1076019583 10:127061364-127061386 AAATATACAGAAAGGGAGGGTGG - Intronic
1076231681 10:128824651-128824673 AAAAATACAAAAATGGTGGAGGG + Intergenic
1076928548 10:133509375-133509397 AAACAAACAAAAGTCGAGGAAGG + Intergenic
1077493901 11:2875797-2875819 AAAAAAGTAAAAGTGGAGGTGGG + Intergenic
1077796736 11:5500149-5500171 AAATACACAGAAGAGTAGGTGGG - Intronic
1077892126 11:6426538-6426560 AGATATAGAAAAGTAGATGTGGG - Intergenic
1078009095 11:7557104-7557126 AAAAATATAAAAGAGGAGTTAGG - Intronic
1079363831 11:19792105-19792127 TTATATACCAAAGTGGTGGTGGG + Intronic
1079570253 11:21934410-21934432 GAATAAACAAAAGAGGAAGTTGG - Intergenic
1079828986 11:25237103-25237125 AAATATAGAATAGTTGAGGGAGG - Intergenic
1080474699 11:32579154-32579176 AAAAAAAAAAAAGTGGAGGGTGG + Intergenic
1080831743 11:35900450-35900472 AAAAATAGAAAAATGGAGCTGGG + Intergenic
1081144891 11:39550868-39550890 AAATATACCAGTGTGCAGGTTGG + Intergenic
1081485988 11:43529601-43529623 AAAGATATAGAAGAGGAGGTGGG - Intergenic
1081952971 11:47061749-47061771 AAATAAACAAAACGGGAGCTAGG - Intronic
1083695928 11:64442367-64442389 AAAGATGCAAATGTGGAGGATGG - Intergenic
1083974174 11:66103826-66103848 AAATATACAAAAATAGAGAAAGG + Intronic
1084139879 11:67219375-67219397 AAATATACAACATTGAAGATCGG + Exonic
1084301383 11:68254801-68254823 AAATAGACAACAGGGGAGGTAGG - Intergenic
1084472939 11:69373800-69373822 AAATATACAAAAAAGTAGCTGGG + Intergenic
1084537863 11:69768446-69768468 AAATTAACAAAAGAGGAGATGGG - Intergenic
1084585132 11:70055975-70055997 AAATAAACAAAAGGTGGGGTGGG - Intergenic
1085249113 11:75130249-75130271 AAAAATACAAAAATTGGGGTGGG + Intronic
1085745541 11:79111382-79111404 AAAAATACAAAAGATGAGCTGGG + Intronic
1086763182 11:90659976-90659998 AAAAACATAAAAGTGGAAGTAGG - Intergenic
1086774014 11:90806962-90806984 AAACTTACAATAATGGAGGTAGG + Intergenic
1086891865 11:92267572-92267594 AAAAAAAAAAAAGTGGTGGTGGG + Intergenic
1087269982 11:96101205-96101227 AAATCTAAGAAAGGGGAGGTGGG - Intronic
1087531771 11:99391636-99391658 TAATATAGAAAGGTGAAGGTAGG + Intronic
1087688756 11:101295768-101295790 AAAGATACAGAATTGCAGGTTGG - Intergenic
1087884986 11:103469862-103469884 TTATATACAAAAGTTAAGGTTGG + Intronic
1088478688 11:110271024-110271046 AAAAAGAAAAAAGTGGAGATTGG + Intronic
1088589363 11:111389840-111389862 AAAAAAACAAAAGTGGAGGGAGG + Intronic
1088603178 11:111501948-111501970 AAATAAACAAACGTGAAAGTAGG + Intronic
1089041544 11:115455331-115455353 AAAGAAAAAAAAGTGGAGGGTGG + Intronic
1089543193 11:119203413-119203435 AAATGTACAAGAGAGGGGGTTGG - Intergenic
1089909712 11:122084812-122084834 AAAAATACAAAAATTGAGGCTGG + Intergenic
1090024009 11:123152360-123152382 AAAAATACAAAAATGTAGCTGGG + Intronic
1090552338 11:127836434-127836456 AAATATACAAATATGGAAGGTGG + Intergenic
1090769645 11:129908648-129908670 AAATATATAAAAGTAGAGAGAGG - Intronic
1092364920 12:7869736-7869758 TAATATACGTAAGTGGTGGTGGG - Intronic
1092383116 12:8014344-8014366 TAATATACGTAAGTGGTGGTGGG - Intergenic
1093122594 12:15290864-15290886 CAAAATACAAAAATGGAGGCTGG + Intronic
1095413541 12:41950075-41950097 AAAAAAAAAAAAGTGGAGTTCGG - Intergenic
1096830364 12:54309167-54309189 AAAAATACAAAAGTGTAGCCGGG - Intronic
1097372512 12:58801544-58801566 AAATGTTCAAAACTTGAGGTAGG - Intronic
1098065985 12:66616676-66616698 AAGTATACAAAAGGTGAGGGAGG + Intronic
1098364486 12:69688401-69688423 AAAAATACAACAGTGGAATTCGG - Intronic
1098435221 12:70461383-70461405 AAATCCCCAACAGTGGAGGTGGG + Intergenic
1098515782 12:71375133-71375155 AAATAGAGAAAAGTTGGGGTAGG + Intronic
1098615979 12:72522945-72522967 AAGTAAACAAAAGTGGAATTAGG - Intronic
1099003225 12:77205846-77205868 CAATATACAACAGTGGAACTGGG - Intergenic
1099192299 12:79573109-79573131 AAATATGCAAAAGTACAGGCCGG + Intergenic
1099672216 12:85708934-85708956 AAAAATAAAAAAGTGGTAGTTGG - Intergenic
1100185184 12:92130836-92130858 AAAAATACAAAAACTGAGGTGGG + Intronic
1100233925 12:92638206-92638228 AAATATACAAAAATATAGCTAGG + Intergenic
1100316408 12:93448822-93448844 AAATAAATAAAAGTGGATGGAGG + Intergenic
1101358048 12:103999251-103999273 AATTATACATAAGCGGAGTTTGG + Intronic
1101394165 12:104329486-104329508 AAATATACAAAAAATGAGATCGG + Intronic
1101826122 12:108221393-108221415 AAAAATACAAAAATTGAGCTGGG + Intronic
1101874025 12:108587307-108587329 AAATATCCAGGAGTGGTGGTGGG - Intergenic
1102501131 12:113353348-113353370 AAAAATACAAAATTAGTGGTGGG + Intronic
1102538184 12:113597698-113597720 AAATATCCAATTGTAGAGGTGGG + Intergenic
1102739439 12:115194064-115194086 AAATTTACAAAAGGGGAGACAGG + Intergenic
1103244938 12:119448649-119448671 AAATAGACAAGAATGGCGGTGGG + Intronic
1104109720 12:125693841-125693863 AAAAAAACAAAACTGGAGGCTGG + Intergenic
1106174010 13:27313018-27313040 AAAAATACAAAATTTAAGGTCGG - Intergenic
1106920189 13:34554958-34554980 AATCAAACAAAATTGGAGGTAGG + Intergenic
1106924691 13:34601452-34601474 AAGAATACAAAACAGGAGGTAGG + Intergenic
1107891849 13:44921032-44921054 AAAAAAAAAAAAGTGGGGGTGGG + Intergenic
1108618755 13:52160473-52160495 ATATATATAAAGGAGGAGGTGGG + Intergenic
1109267560 13:60218579-60218601 AAGAATAAAGAAGTGGAGGTGGG - Intergenic
1109938207 13:69322560-69322582 AAAAAGAAAAAAGTGGTGGTTGG - Intergenic
1110179731 13:72601463-72601485 AAATAAACAAAAATGGACTTTGG - Intergenic
1110303379 13:73955928-73955950 AAATGTGGAAAAGCGGAGGTGGG - Intronic
1110486542 13:76051351-76051373 AACTACACAAAAGTGGAAATTGG + Intergenic
1110677660 13:78268545-78268567 AAATAAATAAAAGTGAAGGCAGG - Intergenic
1110913803 13:80997102-80997124 AAATACACAAAAGAGGAAGAAGG - Intergenic
1111386972 13:87539949-87539971 AAATCTGGAAAAGAGGAGGTGGG + Intergenic
1111483751 13:88867749-88867771 AAAAATACAAACGTTGAGCTGGG + Intergenic
1112035593 13:95493548-95493570 AAAAAAAAAAAAGTGGGGGTAGG - Intronic
1112272153 13:97977381-97977403 AACTTCACAAAACTGGAGGTGGG - Intronic
1112983561 13:105418125-105418147 AAATATACAAAGGATGAGGAAGG - Intergenic
1113490578 13:110688610-110688632 AAATATACTAAAGAGGAGGCTGG + Intronic
1114161177 14:20169453-20169475 AAAAATACAAAAATGTAGCTGGG + Intergenic
1114192431 14:20450190-20450212 TAATACAAAAAAGTGGTGGTGGG - Intronic
1114619671 14:24087915-24087937 AAAAATACAAAAACTGAGGTGGG + Intronic
1114879001 14:26760339-26760361 AAACATACAATAGTGCAGATAGG + Intergenic
1115411902 14:33084665-33084687 GAATATACAAGAGAGGAGGTCGG + Intronic
1115503678 14:34073197-34073219 AAACCAACAAAAATGGAGGTAGG + Intronic
1116529329 14:45948363-45948385 AAAAATACAAAAGTGCATTTGGG + Intergenic
1117562656 14:56957555-56957577 AAATATACAAAAGACGATGTTGG + Intergenic
1118615250 14:67570718-67570740 AAAAATAAAAAGGAGGAGGTAGG - Intronic
1120749947 14:88187962-88187984 AAAAAGACAAAAGAAGAGGTAGG - Exonic
1120798555 14:88663979-88664001 AAGTATTGAAAAGTGTAGGTTGG + Intronic
1122073520 14:99221009-99221031 AAATATAAAAAAATGTAGCTGGG - Intronic
1123876330 15:24627420-24627442 GAATATACTGGAGTGGAGGTTGG + Intergenic
1124047959 15:26168253-26168275 AAATATACAAAAGAGTTGGAAGG - Intergenic
1124210636 15:27762269-27762291 AAAAATACCATAGTGGAGGTGGG - Intronic
1124452632 15:29810301-29810323 ACCTATAGAAAAGTGGATGTGGG - Intronic
1124454961 15:29833810-29833832 AAAAATATAAATGAGGAGGTTGG - Intronic
1124576688 15:30915330-30915352 ACAGATACAAAAGTGCAGCTAGG + Intronic
1125785279 15:42311132-42311154 AAACATAGAAAAGTTGAAGTTGG - Intronic
1126223484 15:46242340-46242362 TAATTTGCAAAAGTGGAGCTTGG + Intergenic
1126427556 15:48545862-48545884 AAATACACAAAAATGTAGCTGGG + Intronic
1127125978 15:55812472-55812494 AAATATACAAAAGCGGGGCGTGG + Intergenic
1127590666 15:60419142-60419164 AAATATACAGCACTGGAGGCCGG - Intergenic
1127639619 15:60903756-60903778 AATTATGCAAAATCGGAGGTCGG + Intronic
1127672999 15:61213351-61213373 AAATATACTTATGTGGAGTTAGG - Intronic
1127699962 15:61489371-61489393 ATTAAAACAAAAGTGGAGGTGGG + Intergenic
1127732691 15:61815252-61815274 AAATAAGCAAAATAGGAGGTGGG + Intergenic
1128433170 15:67619310-67619332 AAATATACAATATGTGAGGTGGG - Intronic
1128969572 15:72095918-72095940 AAAAATACAAAAATTAAGGTGGG + Intronic
1129542379 15:76361031-76361053 AAAAAAAGGAAAGTGGAGGTGGG + Intronic
1130265255 15:82395511-82395533 AAGCAAACAAAAGTGGAGGTTGG - Intergenic
1130607927 15:85334450-85334472 AAATAAATAAAACTGGACGTAGG + Intergenic
1131570250 15:93527746-93527768 CAACATACAAATGTGGGGGTGGG - Intergenic
1132203660 15:99972088-99972110 AAAAATACAAAAAAGTAGGTGGG + Exonic
1133122599 16:3619520-3619542 AAAAATACAAAAATGGAGCTAGG - Intronic
1133981344 16:10635340-10635362 AACTTTACAAAAAGGGAGGTGGG + Intronic
1134157667 16:11856818-11856840 AAAGATGCAAAAGTAGATGTGGG - Intergenic
1135004231 16:18803700-18803722 AAAAATACAAATGGGGAGGCAGG + Intergenic
1135024479 16:18988584-18988606 AAATATACAAAAATTGGGCTGGG - Intronic
1135315571 16:21441897-21441919 AAATATACAAAAATTGGGCTGGG + Intronic
1135368497 16:21874160-21874182 AAATATACAAAAATTGGGCTGGG + Intronic
1135443320 16:22496984-22497006 AAATATACAAAAATTGGGCTGGG - Intronic
1135449102 16:22542368-22542390 AAATATACAAAAATTGGGCTGGG - Intergenic
1135464874 16:22676650-22676672 AAATATCCCCAATTGGAGGTGGG + Intergenic
1135557598 16:23450092-23450114 AAAAATACAAAATTAGAGGTGGG - Intronic
1136001994 16:27301858-27301880 AAAAATAAAGGAGTGGAGGTTGG + Intergenic
1136312256 16:29420641-29420663 AAATATACAAAAATTGGGCTGGG + Intergenic
1136325682 16:29522360-29522382 AAATATACAAAAATTGGGCTGGG + Intergenic
1136440371 16:30262342-30262364 AAATATACAAAAATTGGGCTGGG + Intergenic
1136578419 16:31138136-31138158 AAAAAAAAAAAAGTGGAGATGGG + Intergenic
1137581097 16:49634065-49634087 AAAAATACAAAAATTTAGGTGGG - Intronic
1137852625 16:51761872-51761894 AAATAAACAAACGGGGAGGGAGG - Intergenic
1138671725 16:58621119-58621141 AAAAATACAAAACTTGAGGTGGG - Intronic
1139741475 16:69038881-69038903 AAAAATACAAAAATTTAGGTGGG + Intronic
1139886880 16:70214689-70214711 AAATATACAAAAATTGGGCTGGG + Intergenic
1139931467 16:70530292-70530314 GAATAGACAATAGTGGAGCTGGG - Intronic
1140377330 16:74455094-74455116 AAATGTCCACAAGTGGAGGGCGG - Intronic
1142383882 16:89750064-89750086 AAATATAGAACAGTGCAGGCCGG + Intronic
1142662897 17:1443692-1443714 AAATAAAAAAAAGTGGGGCTGGG - Intronic
1142764975 17:2059584-2059606 AAATATACAAACGAAGAGGAGGG - Exonic
1143833998 17:9675432-9675454 AAAAAAAGAAAAGTGGAGGTAGG + Intronic
1144190196 17:12838660-12838682 AAATAAACAAAATTGGAGATGGG - Intronic
1145715853 17:27020346-27020368 AAAAATACAAAAATGTAGCTGGG + Intergenic
1146800576 17:35816805-35816827 AAAAAAAAAAAAGTGGGGGTGGG - Intronic
1147784735 17:42971149-42971171 AATTATCCAGAAGTGGTGGTGGG + Intronic
1150199401 17:63338770-63338792 ACATATACAAAACTGAAGATAGG - Intronic
1150611113 17:66733805-66733827 AAATAAAAAAAGGTGGAAGTTGG + Intronic
1150858911 17:68780295-68780317 AAATATTGAACAGTGAAGGTAGG - Intergenic
1151395589 17:73820465-73820487 AAATATACAAAAAATTAGGTGGG + Intergenic
1152188680 17:78875035-78875057 AAAAATACAAAAATTAAGGTTGG - Intronic
1152539557 17:80968058-80968080 AAAAAAAAAAAAGTGGAGGAGGG - Intergenic
1153214747 18:2809298-2809320 AAAAAAAAAAAAGTGGGGGTGGG + Intergenic
1153825835 18:8874041-8874063 AAATAATCAGAGGTGGAGGTGGG - Intergenic
1155131109 18:22935268-22935290 AAACAAACAAAAATGGATGTTGG - Intronic
1155724424 18:29061829-29061851 AAATCTAAAAAGGTGGAAGTAGG - Intergenic
1157519632 18:48336734-48336756 AAATATCCAATCCTGGAGGTAGG - Intronic
1157619026 18:49004661-49004683 AAAAATACAATAGTGTAGCTGGG + Intergenic
1157696264 18:49726164-49726186 TAATATAAGGAAGTGGAGGTGGG - Intergenic
1158020098 18:52831768-52831790 TAATATACAAATGTGGATTTAGG + Intronic
1158989384 18:62853182-62853204 AAATATACATAAGGGAAGGAGGG - Intronic
1159185344 18:64964774-64964796 AAATAAACATAAGTAGAGGAAGG + Intergenic
1161246884 19:3257770-3257792 AAATAAAAAAAAATGGAGGCTGG - Intronic
1161402007 19:4070401-4070423 AAAAATACAAAATTAGAGGCCGG - Intergenic
1161699818 19:5788411-5788433 AAATACACACAAGTGGAGCTTGG + Intronic
1162048063 19:8014527-8014549 AAAAATACAAAAATTTAGGTGGG - Intronic
1162144709 19:8606560-8606582 AAAAATACAAAAATGTAGCTGGG - Intronic
1163741878 19:19019595-19019617 AAATATACAAAAATGTATCTAGG + Intronic
1165038483 19:33052120-33052142 AAAAATATAAAACTGGAGGCAGG + Intronic
1165103221 19:33451954-33451976 AAATATACAAAAATAGGGGAGGG + Intronic
1165432064 19:35778516-35778538 AAATATGCACCGGTGGAGGTGGG - Exonic
1165604697 19:37091764-37091786 AAAAATACAAAAATTGAGCTGGG + Intronic
1166286327 19:41831993-41832015 AAAAATACAAAAGTTAAGGCTGG + Intergenic
1166835728 19:45666711-45666733 AAATAAATAAAAGTTGAGGCTGG + Intergenic
1167839294 19:52101055-52101077 AAAAATACAAAAACTGAGGTTGG - Intergenic
1167908729 19:52684072-52684094 AAAAATACAAAAATTGAGCTGGG + Intronic
1168198485 19:54794467-54794489 AAATATACAAAAGATTAGCTGGG - Intronic
925971880 2:9111752-9111774 AAATAAAAAAAAGTGAAGGAAGG + Intergenic
926017326 2:9465586-9465608 AAATATATAAAAGAGGAAATTGG + Intronic
926517666 2:13869335-13869357 AAATAGAAAAGAGTGGAGTTTGG - Intergenic
928525211 2:32132883-32132905 AAAAATACAAAAGATGAGCTGGG + Intronic
928786812 2:34897693-34897715 AATTAAACAAAAGATGAGGTGGG + Intergenic
928969238 2:37009770-37009792 AAAAAAAAAAAAGTGGAGGCGGG - Intronic
929250912 2:39754034-39754056 AAATACATAAAAGTGAAGCTGGG + Intronic
929569893 2:43015949-43015971 AAATTTAAAAAATTGGGGGTTGG + Intergenic
929702416 2:44175253-44175275 AAAAAAACAAAAGTGGGGGTGGG + Intronic
931077997 2:58737880-58737902 AAAGACACAAAAGAGAAGGTGGG + Intergenic
931152766 2:59593211-59593233 AAATATATTAAACTGTAGGTGGG + Intergenic
932260284 2:70321182-70321204 AAAAATACAAAAAAGTAGGTGGG - Intergenic
932317684 2:70796693-70796715 AAATATACAAAAGGACAGGAAGG + Intergenic
932617597 2:73244411-73244433 AAAGATACAAAAGGTGAAGTTGG + Intronic
933079804 2:77971902-77971924 AAAAATACAAAAATGTAGCTGGG + Intergenic
933441816 2:82324158-82324180 AAATATTGAAAAGTGGAGATAGG - Intergenic
933513697 2:83274426-83274448 AAATACAAAAAAATGGTGGTGGG - Intergenic
933707855 2:85304999-85305021 AAACACACAAAAGGGGAGGAGGG - Intronic
935477262 2:103537880-103537902 AAAAATACAAAAAATGAGGTAGG - Intergenic
938029519 2:127980782-127980804 AAAAATACAAAAACTGAGGTGGG + Intronic
938637551 2:133245903-133245925 AAAAAAAAAAAAATGGAGGTGGG + Intronic
939925400 2:148167871-148167893 AAATATAATAAAGTGGTGGTGGG - Intronic
940162384 2:150727121-150727143 AAAAATACAAAAATTGGGGTTGG - Intergenic
940263122 2:151805926-151805948 AAAGATAAAATAGAGGAGGTTGG - Intronic
940671482 2:156674729-156674751 AAATATACACACGTGCATGTGGG + Intergenic
940974635 2:159929488-159929510 AAATATAAAAAAATAGATGTTGG + Intergenic
941175777 2:162195814-162195836 AAAGCAACAAATGTGGAGGTTGG + Intronic
941823462 2:169865988-169866010 AAAAATACAAAAATGTAGATGGG + Intronic
942774473 2:179564753-179564775 AGAAATACAAAAGTTGAGCTTGG - Intronic
942778634 2:179614290-179614312 AAAAATACAGAAGTGGAGCAAGG - Intronic
943899787 2:193418888-193418910 AAAAATACAAAAATGTAGCTAGG - Intergenic
944064613 2:195605551-195605573 AAAAAGAAAAAAGTTGAGGTTGG + Intronic
944218210 2:197276745-197276767 AAATATATAAAAGAGGATGCTGG + Intronic
944276934 2:197849680-197849702 AAATATTCAATGGTGGTGGTGGG + Intronic
944614835 2:201450119-201450141 AAAAATAGAAAACTGGAGCTGGG + Intronic
944754952 2:202751609-202751631 AAATATACAAAAATTTAGCTGGG + Intronic
945313698 2:208346743-208346765 AAATAACCAAACCTGGAGGTTGG + Intronic
945462087 2:210120405-210120427 AAAAATAAAAAAGTGGTGCTGGG + Intronic
945674492 2:212839669-212839691 AAAGATACAAAATTCTAGGTTGG + Intergenic
945868153 2:215199750-215199772 AAAGAGACAGAAGTGGGGGTGGG - Intergenic
946116711 2:217469072-217469094 AAATACACAAAAGTGGGGTGAGG + Intronic
947001830 2:225465553-225465575 AAAAATACAAAAAAGTAGGTGGG + Intronic
947617397 2:231567196-231567218 CAATATATAAATTTGGAGGTGGG - Intergenic
1168937419 20:1677799-1677821 AAAAATACAAAATTGAAGATAGG + Intergenic
1169036362 20:2455728-2455750 CAATATACAAAAGAGGACATAGG + Intergenic
1169299719 20:4431558-4431580 AAACAGATAAAAGTGGAGGTGGG - Intergenic
1169442347 20:5643217-5643239 AAATAAATAAAAGTTGAGATGGG - Intergenic
1171032512 20:21690431-21690453 AATTAGACGAGAGTGGAGGTGGG + Intergenic
1172068590 20:32239414-32239436 AAATATACAATAGGAGATGTAGG - Intergenic
1172256718 20:33525178-33525200 AAAAAAAAAAAAATGGAGGTAGG - Intronic
1172353923 20:34265950-34265972 AAAAAAACAAAAGCGGAGGGGGG + Intronic
1172582202 20:36057287-36057309 AAAAATACAAAAATGAAGCTGGG + Intergenic
1174429005 20:50454355-50454377 AAATAGCAAAAGGTGGAGGTGGG - Intergenic
1174594976 20:51676773-51676795 AAAAATACAAAAATTGAGGTTGG - Intronic
1175068257 20:56308935-56308957 AAAAATACAAAAGAGTAGGCTGG - Intergenic
1176864512 21:14037868-14037890 TAATTTGCAAAAGTGGAGCTTGG + Intergenic
1177087111 21:16719305-16719327 ATATACACAAAAATGGAGTTTGG + Intergenic
1177361944 21:20084437-20084459 AAAAATACAAAAATTTAGGTGGG - Intergenic
1177389509 21:20450044-20450066 AGATATAAAAAACTGGAGGTGGG - Intergenic
1177661736 21:24093075-24093097 AAAGAAAAAAAAGTGGAAGTTGG - Intergenic
1177996417 21:28105069-28105091 AAACATAAAAAAGTGGATGGTGG + Intergenic
1178201152 21:30406930-30406952 AAAAATACAGAAGTTAAGGTTGG - Intronic
1178294209 21:31395238-31395260 AAAAAAAAAAAAGAGGAGGTGGG + Intronic
1178592131 21:33920145-33920167 AAAAAAAAAAAAGTGGGGGTTGG - Intergenic
1178856478 21:36254444-36254466 AAAATTACAAAAGAGCAGGTGGG + Intronic
1179017062 21:37603204-37603226 AAAGTTGCATAAGTGGAGGTAGG - Intergenic
1180651079 22:17377693-17377715 AAATATGCAAATATGGAGGAAGG - Intronic
1182207159 22:28640145-28640167 AAAAATACAAAAACTGAGGTGGG + Intronic
1182514405 22:30845575-30845597 AAAAAAAAAAAAGTGGGGGTGGG + Intronic
1182570931 22:31237265-31237287 AAAAAAAAAAAAATGGAGGTTGG + Intronic
1182619682 22:31612080-31612102 AAAAATACATCAGTGGAGGCCGG + Intronic
1182657249 22:31900436-31900458 TAATACAAAAAAGTGGGGGTGGG + Intronic
1183565545 22:38611801-38611823 AAATATACAAGACTGGACTTTGG - Intronic
1183862198 22:40678449-40678471 AAAGAAAAAAAAGTGGGGGTGGG - Intergenic
1183892787 22:40944198-40944220 AAATAAACTAAAGTGGACTTTGG - Intergenic
1185262303 22:49874532-49874554 AAAAATACAAAAATGGTGGTGGG - Intronic
949735558 3:7167806-7167828 AAATATACAAAAGATTAGCTAGG + Intronic
950186856 3:10950743-10950765 AAATGGACCAAAGTGGAGGGTGG - Intergenic
950739153 3:15035728-15035750 AAAAATACAAAACAGGAGGCTGG + Intronic
951356825 3:21677358-21677380 AAATATACAAATCTGGAGCTTGG + Intronic
952446111 3:33382586-33382608 AAATATTCAAAAGTAGAGAAAGG - Intronic
952623641 3:35377029-35377051 AATTCTACCAAATTGGAGGTTGG - Intergenic
952690073 3:36195096-36195118 AAATGGACAGAAATGGAGGTTGG - Intergenic
952912275 3:38201199-38201221 AAATAGGCAAAAGTTGAGCTGGG - Intronic
953181526 3:40599451-40599473 AAATATAGAAAAGCAGAGTTTGG - Intergenic
953477941 3:43221776-43221798 ATAGTTACAAAAGTGCAGGTGGG + Intergenic
953936164 3:47045221-47045243 AAAAATACAAAAATTAAGGTTGG + Intronic
954099996 3:48364230-48364252 TAATCTCCAAAATTGGAGGTGGG + Intergenic
954244367 3:49318988-49319010 AAATATATTAAATTGGAGGGAGG + Intronic
954288342 3:49635490-49635512 AAATATTCATAACTTGAGGTTGG - Intronic
954739889 3:52740636-52740658 AAAAATACAAAAATGTAGCTGGG + Intronic
955091416 3:55754946-55754968 AGTTAAACAAAAGTGGAGGTGGG + Intronic
955182771 3:56687261-56687283 AAAAATACAAAAGTTAAGGCCGG + Intergenic
955247155 3:57236034-57236056 AAAAAAAAAAAAGTGGGGGTGGG - Intronic
955452626 3:59086377-59086399 AAATAGAAAACAGTGGAGCTAGG - Intergenic
955557459 3:60153375-60153397 AAAAAAAAAAAAGAGGAGGTGGG + Intronic
956125528 3:66007817-66007839 AAAGATACTAAATTGGAGGAGGG + Intronic
956417226 3:69045481-69045503 AAATAAATAAAAGTAGAGGCCGG + Intronic
956573016 3:70718236-70718258 AAATAAAGAAAACTGGTGGTAGG - Intergenic
957719445 3:83974410-83974432 AAACATACAAAAGGAGAAGTAGG + Intergenic
957968081 3:87346678-87346700 AAAAATACAGAAGTATAGGTCGG + Intergenic
958052047 3:88361005-88361027 AAATATCAAAAAGTGGAGTGGGG - Intergenic
958081865 3:88756531-88756553 AAATAGACAAAATTGCATGTCGG + Intergenic
958086445 3:88814297-88814319 AGACATACAAAAATGTAGGTAGG + Intergenic
960713493 3:120554326-120554348 AAAGATAGAAAAGTGCAAGTGGG - Intergenic
960715184 3:120568215-120568237 AAATATCCAAGAGAGGATGTGGG - Intergenic
961042478 3:123687232-123687254 AAATAAATAAATGTGGGGGTGGG + Intronic
961145249 3:124587688-124587710 AAAAAAAAAAAAGTGGAGGGTGG - Intronic
961900852 3:130210029-130210051 AAATAAACAAAAATAGAGCTGGG - Intergenic
962216460 3:133526575-133526597 AAAAATACAAAATTAGAGGGGGG - Intergenic
962805019 3:138920846-138920868 AAAAATACAAAAATTAAGGTCGG - Intergenic
963178781 3:142331194-142331216 ACTGATACAAAAGTGGATGTGGG - Intronic
963475975 3:145805150-145805172 AGACAGACAAAACTGGAGGTAGG + Intergenic
963816399 3:149836043-149836065 AAATTTTAAAAAATGGAGGTTGG - Intronic
964346258 3:155757450-155757472 AAAAATACAAAAATGTAGCTGGG + Intergenic
964829616 3:160869339-160869361 AAAGTTACAAAAGAGGAGGCAGG - Intronic
964833173 3:160908929-160908951 AAAAATACAAATATGAAGGTGGG + Intronic
965125304 3:164619896-164619918 TAATTTCCAAAATTGGAGGTAGG - Intergenic
965843353 3:172932912-172932934 AAATATACAAAAATTGATCTTGG - Intronic
966674232 3:182568048-182568070 AAATATACAACACTGGAGGGGGG + Intergenic
967555900 3:190858404-190858426 AAATAAATAAAAATAGAGGTGGG + Intronic
967970301 3:194994396-194994418 AAAAAAAAAAAAGTGGGGGTGGG + Intergenic
968332136 3:197879923-197879945 CAATACACAGAAGTGGATGTTGG - Intronic
969649983 4:8460355-8460377 GAATATACAAAAGTAGAGAGAGG + Intronic
970130551 4:12865342-12865364 ACATATACTCTAGTGGAGGTGGG - Intergenic
970747623 4:19318443-19318465 TAATATATAAAAATGGAGGGTGG + Intergenic
970843861 4:20512098-20512120 AAATATTCGAAAGTGGAAGTCGG + Intronic
970855082 4:20641811-20641833 AAACATACAAAAATGTAGATTGG - Intergenic
971926281 4:33013150-33013172 CAATAGACAAAATTGGAGGAGGG + Intergenic
973833081 4:54781362-54781384 AAGTATTTAAATGTGGAGGTGGG - Intergenic
975189783 4:71446786-71446808 AAATCTACAAAAGGTGACGTGGG - Intronic
975336583 4:73183632-73183654 AAATACACAAAAATCTAGGTGGG - Intronic
975603068 4:76123865-76123887 AAATATACAAAATTAGTAGTGGG - Intronic
975652708 4:76610545-76610567 AAATATATAAAAGTGGACAGCGG - Intronic
975909783 4:79253301-79253323 GAATATAAAAATGTGGAGTTTGG + Intronic
976265446 4:83184415-83184437 ATAGATACAAAAGTAGAAGTTGG - Intergenic
976507900 4:85870801-85870823 AAATATCAAGAAGGGGAGGTTGG + Intronic
977304599 4:95306852-95306874 AAATATACAAAGCTGCAGGTTGG + Intronic
977371975 4:96148856-96148878 AAAAATAAAAAAGTAAAGGTAGG + Intergenic
977517488 4:98039528-98039550 GTATACACAAAAGTGGAGGGTGG + Intronic
978166849 4:105619623-105619645 AGATTTAGAAAAGTGGAGATTGG + Intronic
978742941 4:112159298-112159320 AAATATAGAGAACTGGAAGTGGG - Intronic
979203717 4:118009357-118009379 ACATAAACCAAAGTGCAGGTTGG + Intergenic
979828150 4:125265966-125265988 ACATAGACACCAGTGGAGGTGGG + Intergenic
980070365 4:128237035-128237057 AAAAAAAAAAAAGTGGGGGTGGG + Intergenic
980216942 4:129864508-129864530 AAATATAAAAAAGTAAAGGAGGG - Intergenic
980265466 4:130508623-130508645 AAAAATATAAAGGTGGAGGAAGG + Intergenic
981268083 4:142811172-142811194 ATATATGCACAGGTGGAGGTAGG - Intronic
981486660 4:145294133-145294155 GAAGATACAAAAGTGGAGGCAGG + Intergenic
981927380 4:150154672-150154694 AAATGTACAGAAATGGAAGTGGG + Intronic
982008271 4:151083420-151083442 AAAAATACAAAAATGTAGCTGGG + Intergenic
982302628 4:153895444-153895466 CAATACACAAAAGTGGGGGAAGG - Intergenic
982514233 4:156324214-156324236 AAAAAGAAAAAAGTGGTGGTGGG - Intergenic
983757136 4:171353378-171353400 AAATAGAGAAAAGAGGAGGAAGG + Intergenic
983769146 4:171526561-171526583 AAATATACATAAGTTCAGCTGGG + Intergenic
984047335 4:174816405-174816427 AAATATACAGAACTGGAAATAGG - Intronic
984108584 4:175580835-175580857 AAAAAGAAAATAGTGGAGGTTGG - Intergenic
985353644 4:189094435-189094457 ACATATCCAAGAGTGGAAGTTGG + Intergenic
986092748 5:4526280-4526302 AAATATACAAAAATGGGAGTGGG + Intergenic
986601217 5:9474892-9474914 AAAAGTACAAGAATGGAGGTGGG - Intronic
986687469 5:10287165-10287187 CAATGTACCAAAGTGGAGGTGGG + Intronic
987473058 5:18356405-18356427 AGATAAAAAAAAGTGGAGGAAGG - Intergenic
987604782 5:20119105-20119127 AAATCTACAAAAGTAGAGGTGGG - Intronic
987801920 5:22709049-22709071 AAATATAGAAATGTGGATGGGGG + Intronic
988222054 5:28359927-28359949 TAATATAAGAAAGTGGAAGTGGG + Intergenic
988446073 5:31287383-31287405 AAATATCCAAAGGTGGATTTTGG - Intronic
988516131 5:31906367-31906389 AAAAATACAAAAACTGAGGTGGG - Intronic
989090070 5:37721277-37721299 AAATAAATAAAAGCGGGGGTGGG - Intronic
989323095 5:40159801-40159823 AAAAATACAAAAAAGTAGGTGGG - Intergenic
989381443 5:40813250-40813272 AAATAAATAAAAGTGGAGGATGG - Intergenic
990037392 5:51338340-51338362 TTATATACAAATGTAGAGGTAGG - Intergenic
990227170 5:53667493-53667515 AAAAAAAAAAAGGTGGAGGTGGG + Intronic
991606275 5:68404640-68404662 AAAAATAAAAAAATGAAGGTGGG - Intergenic
992320485 5:75608729-75608751 AAAAATTCGGAAGTGGAGGTGGG + Intergenic
992738554 5:79748788-79748810 AAATAAAGGAAACTGGAGGTGGG - Intronic
993949521 5:94156709-94156731 AAATATAATAAAGTTGTGGTAGG - Intronic
993953630 5:94205448-94205470 AAATATAAAAAAGTGGTGGTGGG - Intronic
994534699 5:101014092-101014114 AAATATACAAAAATACAAGTGGG + Intergenic
995264968 5:110148594-110148616 ATATATATAAAAGGTGAGGTTGG + Intergenic
995639730 5:114241473-114241495 AAATATACCAAAATGGAGTCAGG + Intergenic
995797282 5:115955488-115955510 TAACATAAAAAATTGGAGGTGGG - Intergenic
995832352 5:116367142-116367164 AAATTTACAAAAAGGGAGCTGGG - Intronic
995989368 5:118217725-118217747 ATATATACAAATTTGGAGGAAGG + Intergenic
996195392 5:120600140-120600162 AATTAAACAAAAATGGAGCTGGG - Intronic
996635514 5:125684670-125684692 AAAAATACAAACGTGGAAGGAGG - Intergenic
997322656 5:132991497-132991519 AAAAATACAAAAACTGAGGTGGG - Intergenic
997428454 5:133820498-133820520 AAATATACATAAGTGGAGTAGGG - Intergenic
998117974 5:139552976-139552998 AAAAATACAAAATTAGAGGCCGG - Intronic
998255884 5:140587713-140587735 AAATAGCCAAAAGTGTAGCTAGG + Intronic
999594578 5:153188439-153188461 AAAAATAAAAAAGATGAGGTTGG + Intergenic
999888575 5:155951668-155951690 AAAAAAATAAAAGTGGAGATAGG + Intronic
1000465768 5:161574135-161574157 AAATGAACAGAAGTGGAGGGAGG + Intronic
1001020748 5:168180417-168180439 TGAAACACAAAAGTGGAGGTGGG - Intronic
1001605791 5:172958921-172958943 AGATAGAAAAAAGTAGAGGTAGG + Exonic
1002042206 5:176522666-176522688 AAAAATACAAAAATGAAGGCCGG - Intergenic
1002552923 5:180010518-180010540 AAAAATACAAAAATGTAGCTGGG - Intronic
1002553017 5:180011474-180011496 ATATATACAAAGGTTGAGGGTGG + Intronic
1002569792 5:180133769-180133791 AAACATACAAAAGTGAAGAATGG - Intronic
1003274012 6:4633063-4633085 AAAAATACAAAAATGGTGGCGGG + Intergenic
1003611180 6:7616355-7616377 AAAAAAAAAAAAGTGGAGGTGGG - Intergenic
1003771982 6:9315486-9315508 AAATATACAAAATATGATGTTGG + Intergenic
1004317591 6:14603638-14603660 GAAAATACAAAAGTGGAGTATGG + Intergenic
1004319981 6:14624840-14624862 AAAAAGACAAAGATGGAGGTGGG - Intergenic
1004777789 6:18868051-18868073 AAAAATACAAAAAAGGAGCTGGG + Intergenic
1005166721 6:22931143-22931165 AAAAATACAGAAGTTGAGGCTGG - Intergenic
1005198199 6:23313293-23313315 AAATAGACAAACTTGGAGATGGG + Intergenic
1005422995 6:25672386-25672408 AAAAATTAAAAAGTGGAGTTGGG + Intronic
1006570627 6:35000489-35000511 AAAGAAAAAAAAGTGGAGGGAGG + Intronic
1008225776 6:48914210-48914232 AAATAAACAAAATTGGAGAATGG - Intergenic
1008456818 6:51720611-51720633 AAATTTAGAATAGTGGTGGTGGG - Intronic
1008563091 6:52740941-52740963 AAATATCCAAAAACGGAGGGTGG - Intergenic
1008640938 6:53462217-53462239 AAAGATGAAAAAGTGGAGGCAGG - Intergenic
1008704953 6:54146205-54146227 AAATATGCAAGAAAGGAGGTTGG - Intronic
1008916472 6:56792906-56792928 AAAAATACAAAAATGTAGCTAGG + Intronic
1009406448 6:63319365-63319387 AGAAATACAAGAGTGAAGGTTGG + Intronic
1009423255 6:63486795-63486817 AAACATACAAAAACTGAGGTGGG - Intergenic
1009685893 6:66956797-66956819 AAATACACAAAAGTTTATGTTGG + Intergenic
1010026800 6:71228067-71228089 AAATAAACAAAAGTGGAAGCAGG - Intergenic
1010135898 6:72552623-72552645 AAAAATACAAAAATTTAGGTGGG - Intergenic
1011681124 6:89784166-89784188 AAATAGCCAAAAGTGGTGGTGGG + Intronic
1012736806 6:102958027-102958049 AAATATAAAGAAGTGGGAGTCGG - Intergenic
1013092574 6:106913408-106913430 AAATATACAAAACTGTAGAAGGG - Intergenic
1013155201 6:107486831-107486853 AAAGAAACAAATGGGGAGGTTGG + Intergenic
1013224238 6:108108515-108108537 AATGATACAAGAGTGGAGTTGGG - Intronic
1014988690 6:128046707-128046729 GAATTTACAAAAGTGGAGGGTGG - Intronic
1015235555 6:130966945-130966967 AAATATACTGAAGTGAAGGCTGG - Intronic
1015993343 6:138971587-138971609 AGATAAAAAAAAGTGGGGGTAGG + Intronic
1019560290 7:1652548-1652570 AAAAAAAAAAAATTGGAGGTTGG - Intergenic
1020205615 7:6113062-6113084 AAAAATACAAAAATGTAGCTGGG - Intronic
1020353003 7:7243695-7243717 GAAGATACAAAAGTGAAGTTAGG + Exonic
1020847180 7:13300964-13300986 AAATATTCATAAGTGGGGTTGGG + Intergenic
1021150592 7:17146243-17146265 AATCATACAGAAGGGGAGGTAGG + Intergenic
1021349742 7:19576976-19576998 AAATATAAAAATGTGGAAATAGG + Intergenic
1022398383 7:30011713-30011735 AAAAGTACAAAAGCTGAGGTTGG - Exonic
1024813668 7:53243003-53243025 GAAGAAACAAAAGTGGAGGCCGG - Intergenic
1025156383 7:56610577-56610599 AAATATTTAAAAGAAGAGGTTGG - Intergenic
1025169157 7:56740719-56740741 AAAAAAAAAAAAGTGGTGGTAGG - Intergenic
1025245663 7:57314887-57314909 AAATAGCAAAAGGTGGAGGTGGG + Intergenic
1025703234 7:63839166-63839188 AAAAAGAAAAAAGTGGTGGTAGG + Intergenic
1025966586 7:66278621-66278643 AAATATACAAAAAAGTAGCTGGG + Intronic
1026007616 7:66612418-66612440 AAATATACAAAATTAGACGGGGG - Intergenic
1026101777 7:67389862-67389884 AAAAATACAAAAAAGTAGGTGGG + Intergenic
1026125891 7:67579181-67579203 AAAAATACAAAAATTGAGCTGGG + Intergenic
1026542830 7:71295610-71295632 AAAGAAAAGAAAGTGGAGGTGGG - Intronic
1027473318 7:78599234-78599256 AAGTATACAAAAATGGAACTGGG - Intronic
1027905913 7:84181131-84181153 ACATATACAAAATTTGAGGAGGG - Intronic
1028416371 7:90584733-90584755 AGATTTACAAAACTAGAGGTGGG - Intronic
1028437338 7:90820043-90820065 AAATACAAAAAAGTGGGGTTGGG - Intronic
1028676443 7:93468631-93468653 AATTCTGCAAGAGTGGAGGTGGG - Intronic
1028765704 7:94556632-94556654 AAATATTTAAAATAGGAGGTGGG - Exonic
1028881119 7:95880956-95880978 AAAGATAAAAAAATGGAGGGAGG - Intronic
1028979210 7:96948461-96948483 AGAGATAGAAAAGTGGAGCTGGG - Intergenic
1029102271 7:98141629-98141651 AAATAAACCAAAGAGGAGATGGG - Intronic
1029208049 7:98880914-98880936 TAATAGACAAAATTGGAGTTGGG + Intronic
1030150765 7:106402788-106402810 AACACTACAACAGTGGAGGTGGG + Intergenic
1030480741 7:110100822-110100844 AAATAAAAAAAAATAGAGGTTGG + Intergenic
1031112713 7:117631132-117631154 CAAAATCCAAAATTGGAGGTTGG - Intronic
1032453735 7:132056201-132056223 AAACAGCCAAAAGTGGAGCTAGG + Intergenic
1032656450 7:133935738-133935760 AAATATTCTAAAGTGGTGATGGG + Intronic
1032873762 7:136014585-136014607 AAATATATAAAATTGGATATTGG - Intergenic
1032900462 7:136301389-136301411 AAAAATACAAAAGAGTAGCTGGG + Intergenic
1033834914 7:145298627-145298649 AAATATGCAAAAGTGGATGAGGG - Intergenic
1033919272 7:146368716-146368738 AAATAAACAAAACTGGGGATAGG - Intronic
1034058498 7:148063361-148063383 GAATTTCCAAAAGTGGGGGTTGG - Intronic
1034398748 7:150847556-150847578 CTATATACAAAGGTGGAGCTAGG - Intronic
1034710138 7:153184003-153184025 AAATATACAAAAAAGTAGCTGGG + Intergenic
1035004813 7:155648207-155648229 AAATATACAAAAGTGGAGGTGGG - Intronic
1035145450 7:156811104-156811126 AACTATTCAAAAGTGGGGCTGGG - Intronic
1035655400 8:1301433-1301455 GAAAAAAAAAAAGTGGAGGTTGG - Intergenic
1036253325 8:7183426-7183448 AAAAAAACAAAAGTTGATGTTGG - Intergenic
1036364170 8:8104052-8104074 AAAAAAACAAAAGTTGATGTTGG + Intergenic
1037215031 8:16439226-16439248 GAATAAACAAAAGTGGAATTAGG + Intronic
1037865260 8:22438166-22438188 AAAAAAAAAAAAGTGGGGGTGGG + Intergenic
1038223099 8:25629301-25629323 ATATATACAAAAGAGGAGTGGGG + Intergenic
1038322048 8:26536234-26536256 AAAAATACAAAAATTAAGGTTGG - Intronic
1038349702 8:26764618-26764640 ATATAAAGAAAAGAGGAGGTGGG - Intronic
1038948320 8:32385993-32386015 AAATAAACAAAAGTAAGGGTTGG - Intronic
1039059599 8:33563159-33563181 GAATATACAAAAGTCCAAGTTGG - Intronic
1039387541 8:37149325-37149347 ATCTATTCCAAAGTGGAGGTGGG + Intergenic
1039800572 8:40951238-40951260 AAAAATACAAAAACTGAGGTGGG + Intergenic
1040943637 8:52858172-52858194 AAAAATACAAAAATGTAGCTGGG - Intergenic
1041141214 8:54821121-54821143 AAAAATAGAAAAGAGAAGGTAGG + Intergenic
1041458197 8:58082822-58082844 AAAAAAACAAAAATGGAGATGGG - Intronic
1041512214 8:58664671-58664693 AAAAATACAAAAGATGAGCTGGG - Intergenic
1042135840 8:65632277-65632299 AAAAATACAAAAGCTGAGGTGGG + Intronic
1043196853 8:77305108-77305130 CAAAATACAAAACTGGAGTTGGG - Intergenic
1043847898 8:85182113-85182135 TCATTTACAATAGTGGAGGTGGG + Intronic
1044358381 8:91253134-91253156 ATATATACAAAACTGAAGTTGGG + Intronic
1044955336 8:97474378-97474400 AAATATAAAAAGGAGGAGGGTGG - Intergenic
1044966236 8:97576417-97576439 AAAAATACAAAAGCTGGGGTGGG + Intergenic
1044978012 8:97684915-97684937 AATTATACAGATGTGGTGGTGGG + Intronic
1045279684 8:100739297-100739319 AAAAATACAAAAGTTTAGCTGGG + Intergenic
1045303311 8:100933995-100934017 AAAAATACAAAAAATGAGGTGGG + Intronic
1045402942 8:101836551-101836573 AAACAGACAAAAGTGGAGTTGGG - Intronic
1045420416 8:102009028-102009050 AAAAATAAAAAAGTGGAGAAGGG + Intronic
1046042780 8:108927120-108927142 AAACAAACCAAAGTGGACGTGGG - Intergenic
1046388045 8:113529065-113529087 AAATATACAAGAGTGGGGGGAGG + Intergenic
1046631401 8:116626137-116626159 CCAAATACAACAGTGGAGGTAGG - Intergenic
1047210876 8:122839333-122839355 AAATATAAACAAGTGGAAGAAGG - Intronic
1047216773 8:122882501-122882523 AAATATACAGAATTGGACTTTGG + Intronic
1047982780 8:130200246-130200268 AAATATTCAAAACAGGAAGTTGG + Intronic
1048175350 8:132147396-132147418 AAAAAATCAAAAGTGGAGTTTGG + Intronic
1049948675 9:623215-623237 ATAAAAAAAAAAGTGGAGGTGGG + Intronic
1050205118 9:3188099-3188121 AAATTAAGAGAAGTGGAGGTTGG + Intergenic
1050934361 9:11376189-11376211 AAAACTACAAAGTTGGAGGTAGG - Intergenic
1051215703 9:14795035-14795057 AAAAATAATAAAGTGGAGATTGG + Intronic
1051966685 9:22836459-22836481 AAATATACCATGTTGGAGGTAGG + Intergenic
1052117740 9:24669009-24669031 AAAAAAAAAAAAGTGGAGGGTGG - Intergenic
1052393039 9:27903549-27903571 AAATAGAAAAAAGTAGATGTTGG - Intergenic
1052697477 9:31896554-31896576 AAATAAACAAGAGTGAAGGAGGG + Intergenic
1052908098 9:33854869-33854891 AAATAAAAAAATGTGGAGGTGGG - Intronic
1053837236 9:42152715-42152737 CAATATACTAAAGTGCAGGCCGG + Intergenic
1054856124 9:69901296-69901318 AAATATACAAAAATTTAGCTGGG - Intronic
1055110368 9:72553266-72553288 AAATATACAGAATTGGAGCCAGG - Intronic
1055612608 9:78038448-78038470 ATGAATACAAATGTGGAGGTCGG - Intergenic
1056394181 9:86166531-86166553 AAAAATACAAAAAAGCAGGTTGG + Intergenic
1057061735 9:92010094-92010116 AAAAATACAAAAATTGAGGCTGG + Intergenic
1057065434 9:92045338-92045360 AAAAAAAAAAAAATGGAGGTTGG - Intronic
1059333679 9:113554464-113554486 AAAAATACAAAAATGTAGCTGGG - Intronic
1059469422 9:114493360-114493382 AAAAAAAAAAAAGTGGGGGTGGG + Intronic
1059936456 9:119316245-119316267 AAATATACAAAAAATGAGATGGG - Intronic
1060987431 9:127827856-127827878 AAAAATACAAAAAATGAGGTGGG + Intronic
1061122231 9:128650696-128650718 AAAAATACAAAAATGGGGCTGGG - Intronic
1061142726 9:128778221-128778243 AAATATACAAAAAAGTAGCTGGG + Intergenic
1185839104 X:3372017-3372039 AAATATAGAAAAGCGAAAGTTGG - Intergenic
1187517305 X:19983909-19983931 AAATATAAAAAAATGTAGCTGGG + Intergenic
1188685301 X:33062335-33062357 ACATATTCAAAAATAGAGGTTGG - Intronic
1189391690 X:40581564-40581586 AAATATACATAAGGGAAGGGAGG - Intronic
1189979336 X:46493566-46493588 AAATATTCAAAAATGAAGGCAGG + Intronic
1190154836 X:47981737-47981759 AAAAATACAAAAATGTAGCTGGG + Intronic
1190278825 X:48916550-48916572 AAAAATACAAAATTAGAGGCCGG + Intronic
1190293012 X:49005476-49005498 AAAAATACAAACGTGGTGGTGGG - Intergenic
1190378864 X:49818475-49818497 AAATGCACCAAAGTGGAGTTTGG + Intergenic
1190852861 X:54263801-54263823 AAATATAAAAATATGGAAGTGGG - Intronic
1191844620 X:65537597-65537619 AGATACACAAAAGTGGACGTTGG - Intergenic
1191887761 X:65906436-65906458 AAAAATACAAAAATGGTGGCAGG + Intergenic
1192085630 X:68094358-68094380 AAAAATAATAAACTGGAGGTAGG - Intronic
1193247099 X:79242180-79242202 AAATAAACACAAATGCAGGTGGG - Intergenic
1194081665 X:89474383-89474405 AAATATACAAAATTTCAGTTCGG + Intergenic
1194128788 X:90053557-90053579 AAATAGACAAAAGTGAATGGAGG - Intergenic
1194461304 X:94172605-94172627 AAATACAAAAAAGTGTTGGTTGG - Intergenic
1194680184 X:96842788-96842810 AAATATACTTTAGTGGGGGTAGG + Intronic
1194816786 X:98451702-98451724 ACATTTACAAAATTGGTGGTTGG - Intergenic
1195292361 X:103441534-103441556 AAAAAAAAAAAAGTGGCGGTGGG + Intergenic
1195693882 X:107652365-107652387 AAATAAACAAAAGTAGACCTGGG - Intergenic
1196794490 X:119491214-119491236 AAAAATACAAAAATGTAGCTGGG - Intergenic
1196920369 X:120579189-120579211 AAAAACAGAAAAGGGGAGGTGGG + Intergenic
1198629905 X:138624718-138624740 AAAAATACAAAAACTGAGGTGGG + Intergenic
1198930620 X:141854856-141854878 AAATATACAACTGAAGAGGTAGG + Intronic
1199134961 X:144238249-144238271 CATTATACAAAAGGGGAGGAGGG + Intergenic
1199455412 X:148022206-148022228 AGATAAAGAAAAGTGGAGGTGGG - Intronic
1199555433 X:149103014-149103036 AAGAATACAAAAATAGAGGTAGG + Intergenic
1200139156 X:153889647-153889669 AAAAATAATAAAGTGGAGGTGGG - Intronic
1200434332 Y:3130573-3130595 AAATATACAAAATTTCAGTTGGG + Intergenic
1200948720 Y:8870989-8871011 AACTAGACAAAAGGGGAGGTGGG - Intergenic
1201236689 Y:11918827-11918849 AAATATAGAAAAGCGAAGGTTGG + Intergenic