ID: 1035006834

View in Genome Browser
Species Human (GRCh38)
Location 7:155669817-155669839
Sequence CTCTATTTCTTCAGGTGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 251}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035006829_1035006834 11 Left 1035006829 7:155669783-155669805 CCAGTGAAGGCTGTTGGGGGAGG 0: 1
1: 0
2: 1
3: 32
4: 348
Right 1035006834 7:155669817-155669839 CTCTATTTCTTCAGGTGAGAGGG 0: 1
1: 0
2: 0
3: 18
4: 251
1035006828_1035006834 12 Left 1035006828 7:155669782-155669804 CCCAGTGAAGGCTGTTGGGGGAG 0: 1
1: 0
2: 0
3: 25
4: 227
Right 1035006834 7:155669817-155669839 CTCTATTTCTTCAGGTGAGAGGG 0: 1
1: 0
2: 0
3: 18
4: 251
1035006823_1035006834 19 Left 1035006823 7:155669775-155669797 CCTAGGGCCCAGTGAAGGCTGTT 0: 1
1: 1
2: 0
3: 19
4: 243
Right 1035006834 7:155669817-155669839 CTCTATTTCTTCAGGTGAGAGGG 0: 1
1: 0
2: 0
3: 18
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035006834 Original CRISPR CTCTATTTCTTCAGGTGAGA GGG Intronic
900884118 1:5403394-5403416 CTCTGTTTCCTCATGTGAGTGGG - Intergenic
901411749 1:9089040-9089062 CTCTTTTTCGTCAGGAGTGAGGG - Intergenic
901955302 1:12779952-12779974 CTTTATTATTTCAGATGAGATGG - Intergenic
903535535 1:24063961-24063983 CTCAATTTCTCCAAGTGACATGG + Intronic
904665390 1:32116799-32116821 CTCTATTTGTTCAAGTGAAAGGG - Intronic
907836157 1:58110540-58110562 CTCAATTTCTTCTTGTGAGATGG - Intronic
908103623 1:60816840-60816862 CTCTAGTCCTTTAGGTAAGATGG + Intergenic
911867666 1:103049487-103049509 GTGTATCTCTGCAGGTGAGATGG + Intronic
914884447 1:151573835-151573857 CTCTATTGCTGGAAGTGAGAGGG + Intronic
918487032 1:185040540-185040562 CTATATTTTTTCAGCTGAAAAGG + Intergenic
919808391 1:201394442-201394464 CTCTACTTCCTCAGGGGAGATGG + Intronic
921666514 1:217878967-217878989 CTCTAGTTCTGCAGGTGGCAAGG + Intergenic
924194316 1:241589447-241589469 CTTTCTGTCTTCAGGAGAGATGG - Intronic
1063164742 10:3450998-3451020 CTCTCTTTCCTCATTTGAGATGG + Intergenic
1064364625 10:14696525-14696547 CTCTATTTTTTCGGGGGAGGTGG + Intronic
1064399443 10:15009168-15009190 ATCTTTTTCTTCAAGAGAGAAGG - Intergenic
1065117674 10:22498236-22498258 CTCTATGTATGCAGGTCAGAGGG + Intergenic
1066132123 10:32404467-32404489 CTCAGTTTCTCCAGGTGACAGGG - Intergenic
1066978651 10:42391570-42391592 CTCTTTTTCATCAGGAGTGAGGG + Intergenic
1068170895 10:53393224-53393246 CTCTGCTTCTTGAGGAGAGAGGG + Intergenic
1069668523 10:70181828-70181850 CTCTATTTATTTATTTGAGATGG - Intergenic
1069873195 10:71545710-71545732 ATCTATGTCTGCTGGTGAGAAGG + Intronic
1071231483 10:83592254-83592276 CTCTATTTATTCATGTGAATTGG + Intergenic
1071945325 10:90637523-90637545 AACAACTTCTTCAGGTGAGAAGG + Intergenic
1072263569 10:93705528-93705550 CTCTACTTCTTTAGCTGACATGG + Intergenic
1072541004 10:96397917-96397939 ATCTCTTTCTCAAGGTGAGATGG - Intronic
1072640108 10:97205366-97205388 CACTGTTTCTTCAGGGAAGAAGG + Intronic
1073544099 10:104334695-104334717 CTATCTTTCTGCTGGTGAGAGGG + Intronic
1074453519 10:113578264-113578286 CCCTATCCCTTTAGGTGAGAAGG - Intronic
1074969680 10:118525860-118525882 CTCTATTTCTGAAGGGAAGAAGG + Intergenic
1075584826 10:123650106-123650128 CTCTAGTGCTTCAGGTGAAGGGG - Intergenic
1076548051 10:131259376-131259398 TTTTAGTTCTTCATGTGAGATGG - Intronic
1078418133 11:11182688-11182710 CTCTTATTCCTCAGGTAAGATGG + Intergenic
1078505372 11:11936999-11937021 CTCTATTTCTACAGGTCCCAGGG + Intronic
1078584695 11:12573032-12573054 CTCAATTGCTTCAGATGGGAGGG - Intergenic
1082948197 11:58782530-58782552 TTTTATTTTTTCAGGAGAGATGG - Intergenic
1083560456 11:63669528-63669550 TTTTTTTTCTTCTGGTGAGAAGG - Intronic
1084845189 11:71893113-71893135 ATCTTTTTCTTCAAGAGAGAAGG + Intronic
1086516725 11:87622041-87622063 CTGTGTCTCTGCAGGTGAGATGG + Intergenic
1088997092 11:115010634-115010656 CATTATTTTTTCAGGTGGGAGGG - Intergenic
1090583375 11:128184124-128184146 CTCTATTTCTTCAGATCAAAGGG + Intergenic
1092509770 12:9143091-9143113 CTCTTTTTCATCAGGGGTGAGGG + Intergenic
1093906167 12:24694110-24694132 CTCTCTGTCTTCAGGTCACATGG - Intergenic
1094253359 12:28392846-28392868 TTCTACTTCTTCAGGTCAAAAGG - Intronic
1096417111 12:51424100-51424122 TTCTTTTTCTTGAGGAGAGAGGG + Intronic
1097981790 12:65742713-65742735 CTCATTTTCTTTAGGAGAGAGGG - Intergenic
1098526365 12:71491396-71491418 TTTTTTTTGTTCAGGTGAGAGGG + Intronic
1099147317 12:79063267-79063289 TTCTATTTTATCAGGGGAGAAGG + Intronic
1099203112 12:79698483-79698505 CTATCTTTCTTTAGGTGAGCAGG - Intergenic
1100743522 12:97620766-97620788 AGCCATTTCTTCAGGTGAAATGG - Intergenic
1101723426 12:107370546-107370568 ATCTATTTTTTCAGGGGAAAGGG - Intronic
1103877270 12:124137941-124137963 ATCTAGTTCTTTAGGTAAGAAGG - Intronic
1104859142 12:131915762-131915784 CTCTTTTTCTTTTGTTGAGACGG - Intronic
1105538440 13:21292561-21292583 CTCTATTTCTTCCAGTGATACGG + Intergenic
1107790543 13:43998016-43998038 CTCTATCACTTCAGGAAAGAAGG - Intergenic
1108031533 13:46235657-46235679 CTCTATTTTTTCACGTCAGATGG + Intronic
1109174716 13:59141096-59141118 ACCTATTTCTAAAGGTGAGATGG - Intergenic
1109572815 13:64214902-64214924 GTCTGTCTCTTCACGTGAGATGG + Intergenic
1111052272 13:82900267-82900289 ATATATTCCTTCAGGTGAGTAGG - Intergenic
1112251674 13:97786782-97786804 TTGTTTTTGTTCAGGTGAGAGGG - Intergenic
1112902819 13:104379703-104379725 CTCTTTCTCCTCAGATGAGAAGG + Intergenic
1114886836 14:26863137-26863159 CTGTATTTTCTCAGGTGAGTGGG - Intergenic
1114945480 14:27675180-27675202 GTCTGTTTCTGCACGTGAGATGG - Intergenic
1114993345 14:28316398-28316420 GTCTGTTTCTGCACGTGAGATGG + Intergenic
1115455878 14:33601882-33601904 TTCTAATTTTTCAGGTGGGAAGG - Intronic
1116169192 14:41377042-41377064 CACTATATCTTCAGATGTGAAGG - Intergenic
1120034083 14:79675890-79675912 CACTATTTTTTTAGGAGAGAGGG - Intronic
1127145389 15:56018185-56018207 CTCTTGCTCTTCAGGAGAGAAGG - Intergenic
1127754131 15:62074299-62074321 CCTTTTTTCTCCAGGTGAGATGG + Intergenic
1128352619 15:66901187-66901209 CTCTGTTCCTTCACGTGAGCTGG + Intergenic
1129368960 15:75076013-75076035 CTCCATTTTTTCTGATGAGAAGG - Intronic
1131884022 15:96890213-96890235 CACTATTTCTTCAAGTCAAAGGG - Intergenic
1133072229 16:3254311-3254333 CACCATTTCTACAGGGGAGAAGG - Exonic
1138246873 16:55474206-55474228 CTCTAAGTGTTCAGGTGAAAGGG - Intronic
1141346427 16:83250835-83250857 CTTTCTTTCTTCAAGTGATATGG + Intronic
1142851927 17:2708490-2708512 CTCAGTTTCCTCAGGTGAGATGG - Intronic
1143830609 17:9647590-9647612 CTAGGTTTCTGCAGGTGAGAAGG - Intronic
1146237817 17:31184774-31184796 CTCTTTTTCTACAGGAGATAAGG - Intronic
1146726311 17:35159207-35159229 CTCCCTTTTTCCAGGTGAGATGG + Intronic
1147037987 17:37695952-37695974 CTGTATTTCTCAATGTGAGAAGG + Intronic
1147236351 17:39060400-39060422 TTCTAATTCTTCATGTGGGAGGG + Intergenic
1148036487 17:44666309-44666331 CTTTATTTCTTCAGTGGAAAAGG - Intronic
1149862689 17:60132298-60132320 CACTATTTCTTCAGCTGGAAAGG - Intergenic
1153328251 18:3844255-3844277 CTCTGATTTTTCAGGTGACATGG + Intronic
1153381453 18:4444241-4444263 ACATATTTCTTAAGGTGAGATGG - Intronic
1155610920 18:27666667-27666689 CTCTGTTTCTTAAGCAGAGAAGG - Intergenic
1155640126 18:28003658-28003680 CTCCATTTCCTCAGGTCATAAGG + Intronic
1155741220 18:29290496-29290518 CTCTATGTATTCAAGTGAAAGGG + Intergenic
1155969835 18:32071858-32071880 CTCTCTTTCTTCAATTTAGATGG + Exonic
1156079308 18:33315016-33315038 CTTTTATTCCTCAGGTGAGAGGG - Intronic
1156616241 18:38788169-38788191 TTTTATGTTTTCAGGTGAGAAGG - Intergenic
1156885124 18:42126482-42126504 CTCTATTTCTTCATGTAACACGG - Intergenic
1157371410 18:47115928-47115950 ATCTTTTTCTTCAGGAAAGATGG - Intronic
1158001795 18:52628091-52628113 CTCTATTTCCACATTTGAGATGG + Intronic
1158138847 18:54235089-54235111 CTCTATCTCTTCAGGGGATTGGG + Intergenic
1159114627 18:64100147-64100169 TTTTTTTTCTTCAGGGGAGATGG + Intergenic
1159479101 18:68964422-68964444 CTCTATTTCTTTGGATGAAAAGG + Intronic
1161370992 19:3910876-3910898 CGCCCTTTCATCAGGTGAGACGG + Exonic
1161865792 19:6831315-6831337 CTCTATTTCTTTTTTTGAGACGG + Intronic
1162063231 19:8109459-8109481 GTCTATTTCAACAGGTGACAAGG + Intronic
1162424269 19:10584572-10584594 CTCTCTTTCTTCTTTTGAGATGG - Intronic
1164108553 19:22133130-22133152 CTATTTTTCTGCAGGTCAGAGGG + Intergenic
1164420750 19:28089886-28089908 CTGTGTCTCTGCAGGTGAGATGG - Intergenic
1164486487 19:28660256-28660278 CTTTATTTCTTCATCTGTGAAGG - Intergenic
1167317992 19:48777508-48777530 TTCTATTTTTTTTGGTGAGATGG + Intergenic
1167755209 19:51408643-51408665 TTGTATTTTTTTAGGTGAGACGG + Intergenic
925843663 2:8016684-8016706 CTCTGTTTCACCAGCTGAGAAGG - Intergenic
927475743 2:23413066-23413088 CTCTATTTCATCCGGTGGAAAGG + Intronic
928500228 2:31884483-31884505 TTCCATGTCTTCAGGTGTGAGGG - Intronic
928711407 2:34010654-34010676 CTCCATTTCCTCAAGTCAGATGG + Intergenic
928719899 2:34108121-34108143 GTCCATTTCCTCAGGTGACATGG + Intergenic
930374015 2:50541211-50541233 CTCTTTTTATTCAGCTCAGATGG + Intronic
930925421 2:56812086-56812108 TACTATTTCTTCCAGTGAGATGG - Intergenic
931101701 2:59009510-59009532 CTTTACTTGTTCAGGTGGGAGGG + Intergenic
932421009 2:71601366-71601388 CTCTATTCCTTGAGGGTAGAAGG - Intronic
932534935 2:72582661-72582683 CTCAATGTCTCCAGCTGAGAAGG + Intronic
933315339 2:80707803-80707825 TTGTATTTTTTCAGGAGAGACGG + Intergenic
935458805 2:103302970-103302992 TTCTGTTTCTTGAGGTAAGAAGG + Intergenic
935935549 2:108178695-108178717 CTCTATTTCTTCACTTGAAAAGG + Intergenic
936637979 2:114281071-114281093 ATTTTTTTCTTCAGGTCAGATGG + Intergenic
937893107 2:126955280-126955302 CTCTATTCCTTCTGGTTTGAGGG - Intergenic
939253534 2:139714478-139714500 CTCTAAGACATCAGGTGAGATGG - Intergenic
939375657 2:141362760-141362782 CTTTCTTTCTTCTGGTGAGGTGG - Intronic
940644241 2:156374140-156374162 CTGTGTTTCTGCACGTGAGATGG + Intergenic
941600673 2:167539945-167539967 CTCTATTCCTTCAGGAGAAAAGG + Intergenic
941662758 2:168212315-168212337 CTCTTTCCCTGCAGGTGAGATGG - Intronic
942111961 2:172691393-172691415 GTATATTTCTTCATGTCAGATGG - Intergenic
942478635 2:176357772-176357794 CTCTACTTCTTCAACTTAGAGGG + Intergenic
942876644 2:180807851-180807873 CTCTATTACTAAAGTTGAGAAGG - Intergenic
944350484 2:198720808-198720830 CTCTTTTTTGTCAGCTGAGAAGG + Intergenic
945133161 2:206596751-206596773 CTCTATTTTCGCAGATGAGAAGG + Intronic
945233910 2:207616837-207616859 CTCTATTTTTTCTTTTGAGATGG - Intronic
1169604063 20:7295559-7295581 ATCTCTTTGTTCAGGTAAGAAGG + Intergenic
1170302185 20:14896581-14896603 CTCTGTTTCCTCAGGTGAGGAGG - Intronic
1171409112 20:24934374-24934396 CCATATGTCTTCAGATGAGATGG + Intergenic
1174681094 20:52409205-52409227 ATGTAGTTCTTTAGGTGAGAGGG + Intergenic
1175101212 20:56580103-56580125 CTCCATTTCTACAGCAGAGAAGG - Intergenic
1178496235 21:33088814-33088836 CTGTATGTCTCCAGGTCAGACGG - Intergenic
1179207759 21:39299608-39299630 CTTTGTTTCTTCAGCTGTGATGG - Intronic
1179395664 21:41038184-41038206 CTCCATTTCTTCATCTGTGATGG - Intergenic
1180882915 22:19219116-19219138 AGCTATTTCTGCAGGGGAGAAGG + Intronic
1183426973 22:37745462-37745484 CTCTTTTCCTGCAGGTGAGTAGG - Intronic
1184194654 22:42918888-42918910 ATGTGTTTCTTCAGCTGAGAGGG - Intronic
1184441004 22:44515180-44515202 CTTTATTTGTTCATGTGTGAGGG + Intergenic
1185100995 22:48840740-48840762 CTCTGTTTCTTCCAGGGAGATGG - Intronic
951396268 3:22171415-22171437 CTTTATTTTCTCAGGTGAGCAGG - Intronic
952209652 3:31216790-31216812 CTCTATCTCTTGAAGAGAGAAGG - Intergenic
952701804 3:36336384-36336406 CAGTATTTCTTCAGGTCAGAAGG - Intergenic
953235903 3:41106290-41106312 TTCTCTTTCTTCAGTTGAGGAGG + Intergenic
954310364 3:49761956-49761978 ATTTATTTTTTCTGGTGAGATGG + Intronic
955222942 3:57038058-57038080 TTCTGATTCTTCATGTGAGATGG - Intronic
956399115 3:68857863-68857885 TTGTATTTCTTCAGGTAATATGG - Intronic
959000525 3:100959088-100959110 CTCTATTCCTACAGGAGGGATGG + Intronic
960087039 3:113602400-113602422 CTTTATTTCTTCTGTTCAGATGG - Intronic
961057055 3:123798162-123798184 CTCTATGTCTTCATTTGTGAAGG - Intronic
961264986 3:125634529-125634551 CTATATTCCATCAGGTGAGGGGG - Intergenic
961989004 3:131167720-131167742 CTCTCTTTCTTCATCTGAGTTGG - Intronic
963464867 3:145666470-145666492 CTCTAATTCTTCATGACAGAGGG - Intergenic
963652262 3:147994719-147994741 GTCTAGTGCTTCAGCTGAGAAGG - Intergenic
964214557 3:154264825-154264847 GTGTGTTTCTGCAGGTGAGATGG - Intergenic
964871899 3:161321573-161321595 CTGTATTTCTTCATGTTTGAAGG - Intergenic
964965091 3:162482162-162482184 CTCTTTTTCTTCAAGTCAGCAGG + Intergenic
965013057 3:163121867-163121889 CTCTCTTTCTTCAAGGAAGAGGG + Intergenic
965458953 3:168937518-168937540 CTCTAAGTATTCAGGTGAAAGGG - Intergenic
965523486 3:169692197-169692219 CTCTCTATCTTCAGGTTAGGGGG + Intergenic
966505147 3:180692422-180692444 TTCTATGTCTCCAGGTGGGAGGG + Intronic
967338258 3:188368467-188368489 CTCTATTTCTTCATCTGTCAAGG - Intronic
967470101 3:189851388-189851410 TTCTTTTTCTTCAGCAGAGACGG - Intronic
968856925 4:3132190-3132212 CTCTTTTTCTTTGGGTGAGAGGG + Intronic
969349055 4:6587563-6587585 CTGTGATTCTTCAGGTGTGAGGG + Intronic
969730023 4:8949294-8949316 ATCTTTTTCTTCAAGAGAGAAGG + Intergenic
969789627 4:9483408-9483430 ATCTTTTTCTTCAAGAGAGAAGG + Intergenic
970113984 4:12672137-12672159 CTCAGTTTCTTCATGTGAAATGG + Intergenic
970587550 4:17529031-17529053 TTTTTTTTCTTCAGGTCAGATGG - Intergenic
970958647 4:21846475-21846497 CTCTGTTTCTTCCTGTGAAATGG + Intronic
971231884 4:24806771-24806793 TTCTGTTGCTTCTGGTGAGAAGG - Exonic
971597178 4:28545431-28545453 CAATATTTCTAAAGGTGAGAAGG - Intergenic
974388268 4:61231345-61231367 TGCTATGTCTCCAGGTGAGAGGG + Intronic
974938593 4:68437162-68437184 ATTTATTTCTTCAGGTAGGAAGG - Intergenic
977203297 4:94141450-94141472 ATGAATTTCTTCAGATGAGAAGG + Intergenic
978010423 4:103675576-103675598 CCCCACTTCTTCAGGTGTGAAGG + Intronic
980156319 4:129111247-129111269 CTCTCTTGCTTCAGCAGAGAAGG + Intronic
981115295 4:140983289-140983311 TTCTGTTTCTTCAGGTCACATGG + Intronic
981344799 4:143662971-143662993 GTGTATTTCTGCAGGTGAGATGG + Intronic
982932935 4:161430970-161430992 TTCTATTTCTCCAGGTTTGAAGG - Intronic
983653583 4:170057369-170057391 TTCTTTTTTTTTAGGTGAGACGG + Intergenic
984209913 4:176834006-176834028 CTCTTTTTCTTCTGGTAATAAGG + Intergenic
984348225 4:178558937-178558959 CACTATTTCTTACGATGAGATGG - Intergenic
986508949 5:8482660-8482682 TTGTATTATTTCAGGTGAGAAGG - Intergenic
986580810 5:9263930-9263952 ATCAATTTCTGCAGGGGAGATGG - Intronic
986944312 5:12996782-12996804 GTGTATTTCTTGAGGAGAGAAGG - Intergenic
987171464 5:15263207-15263229 CTCTCTCTCTTCAGGTGTTAGGG + Intergenic
987791435 5:22573870-22573892 CTCTGTTTCAGCAGGTTAGAGGG - Intronic
989627318 5:43442725-43442747 CTATGTCTCTGCAGGTGAGATGG + Intergenic
990015257 5:51053297-51053319 CTTTATTTCTTGAGGTGGGTGGG + Intergenic
990090053 5:52032933-52032955 ATCTAGTTCCTCAAGTGAGAGGG + Intronic
991468216 5:66937278-66937300 CTTTAGTCCTTCTGGTGAGAGGG - Intronic
995421053 5:111967433-111967455 CTGCAATTCTTTAGGTGAGAGGG - Intronic
997223888 5:132194500-132194522 CTCCCTTTCTTCAAGTGACAAGG + Intronic
999763132 5:154718206-154718228 GTCTATTTCTGCTGGTGAGGTGG - Intronic
1000181221 5:158813387-158813409 CTGGATTTCTTCAGCTGGGAAGG - Intronic
1000697410 5:164404806-164404828 CTGTATTTCATGAGGTGGGATGG + Intergenic
1002865676 6:1120007-1120029 CTCCAGTTCTTCTGGTGAAATGG + Intergenic
1004138730 6:12993915-12993937 GTCTATTTCTTCATGTGATCTGG - Intronic
1006258864 6:32852494-32852516 TTCTCTTTCTCCAGGGGAGATGG - Exonic
1008028196 6:46662955-46662977 CTCTCTTTCTGCAGGAGAAAGGG - Intronic
1009614371 6:65986235-65986257 CTCTATTACTCCAGGTGAGTGGG - Intergenic
1011889131 6:92134921-92134943 CTCTAAATGTTCAGGTGAGTAGG + Intergenic
1012722554 6:102764227-102764249 GTCTCTTTCTTAATGTGAGAGGG + Intergenic
1012882033 6:104801959-104801981 GTGTGTTTCTGCAGGTGAGATGG - Intronic
1016138098 6:140572430-140572452 CTCCATTTATTTAGGTGAGCTGG + Intergenic
1016464683 6:144313762-144313784 CTCTATTTCTGGGGGAGAGATGG + Intronic
1017340581 6:153317157-153317179 TTTTATTTTTTCAGGTGGGATGG - Intergenic
1018333613 6:162760739-162760761 CTCTTTTTCCCCAGGTGGGACGG + Intronic
1019672033 7:2285542-2285564 CTCTATTTCTCCATGTTCGAGGG - Intronic
1019953301 7:4390855-4390877 CTGTGATTCTTCAGGTGACAGGG + Intergenic
1021250444 7:18318783-18318805 CTCTGTTTCTTTATGTGATAAGG + Intronic
1021471778 7:21011287-21011309 TTCCATGTCTTCAAGTGAGAGGG - Intergenic
1022974553 7:35545411-35545433 CTCTCTCTCTGCAGGAGAGAGGG + Intergenic
1025974491 7:66359075-66359097 ATCCATTTCTTCACGTGAGGAGG + Intronic
1026225426 7:68436142-68436164 CTGTATTTTTTCAGTAGAGATGG + Intergenic
1027201359 7:76065741-76065763 CTCAGTTTCTGCAGGTGAGACGG + Intronic
1028125242 7:87105208-87105230 CTCCATTACTGCTGGTGAGACGG - Intergenic
1032070175 7:128800180-128800202 CTCTTTTTCTTCAGTTAATATGG + Intronic
1032400495 7:131620900-131620922 CTCCTTTTCTTTAGGTGTGATGG - Intergenic
1034513871 7:151558459-151558481 CCCAATTTCTTCAGTAGAGAAGG - Intronic
1035006834 7:155669817-155669839 CTCTATTTCTTCAGGTGAGAGGG + Intronic
1035968966 8:4227009-4227031 CATTATCTCTGCAGGTGAGATGG + Intronic
1036179573 8:6572653-6572675 CTCTGTATCCTCAGGTGATAAGG + Intronic
1036806449 8:11837645-11837667 CTTTTTTTCTCCAGGTGAGAGGG + Intronic
1037584859 8:20269344-20269366 CTCTGTCTCTCCAGGTAAGACGG - Intronic
1037747251 8:21655883-21655905 ATCTATTTTTGCAGGTGAAATGG + Intergenic
1037914432 8:22764269-22764291 CTCCATTTTTTCAGGATAGAGGG - Intronic
1039020529 8:33199904-33199926 CTCTATTTCTATAGCTTAGATGG - Intergenic
1039063108 8:33587924-33587946 ATGTATTTCTTCAGTAGAGATGG + Intergenic
1040792204 8:51245055-51245077 CTCTATATCTTCAAGTAAGTTGG + Intergenic
1041010744 8:53540458-53540480 CTTTTTTTCTACATGTGAGATGG + Intergenic
1042185664 8:66134426-66134448 CCTCATTTCTTCAGGTGAAAAGG + Intronic
1042589120 8:70378505-70378527 GTCCATTTCTTCAAGGGAGATGG + Intronic
1042813561 8:72852980-72853002 CTCTTTTTCTGGAGGGGAGAGGG + Intronic
1043854570 8:85250057-85250079 CTCTCTTTCTTCATTTCAGAAGG - Intronic
1046463084 8:114568595-114568617 CTCTGTCTCTCCAGGTGATATGG + Intergenic
1046463243 8:114569850-114569872 CTCTGTCTCTCCAGGTGATATGG - Intergenic
1049390684 8:142368760-142368782 CTTTTATTCTTCAGGGGAGAGGG - Intronic
1050649553 9:7760531-7760553 CTCTACTTCTTGAGTAGAGAAGG - Intergenic
1050720211 9:8580346-8580368 GTCTATTACTTCAGGTGATTAGG - Intronic
1050728068 9:8675247-8675269 CTCTAGTTCCTCAAGTGTGAGGG + Intronic
1051924853 9:22311581-22311603 CTCTTTTTCCACAGATGAGAAGG - Intergenic
1052230721 9:26148208-26148230 ATCTATTTTTTCAGTTGAAATGG - Intergenic
1054856456 9:69904763-69904785 GGCTATTTCTTCAGGTGTTATGG - Intronic
1055162691 9:73150264-73150286 ATTTATGTCATCAGGTGAGAAGG - Intergenic
1056316735 9:85397548-85397570 CTCTTTTTCTTGAGGGGAAAGGG - Intergenic
1056969269 9:91189019-91189041 CTCTGTTAGTTCAGGTGAGATGG - Intergenic
1058256086 9:102765657-102765679 CTCTATTTCTTGTAGTAAGATGG - Intergenic
1059330502 9:113532549-113532571 CATTATTTCTTCACCTGAGATGG - Intronic
1062138792 9:134944180-134944202 CTCTCTTTCTTCATGTGGAAGGG - Intergenic
1185817029 X:3165496-3165518 GTCTATTCCTCCAGGTGAAAGGG + Intergenic
1186353727 X:8768171-8768193 CTCTCTTTCTGCAGGAGGGAGGG - Intergenic
1187018568 X:15355650-15355672 CTATATTTCTTCAATAGAGATGG - Intronic
1187083184 X:16013001-16013023 ATCTACTTCTTCAGGTTTGATGG - Intergenic
1190072707 X:47292193-47292215 CTCTTTTTCATCAGGAGTGAGGG + Intergenic
1191627102 X:63281267-63281289 CAATACTTCTTCAGGTCAGAAGG + Intergenic
1192929753 X:75793426-75793448 CTCTTTTTTTTCATGTCAGAGGG + Intergenic
1193954997 X:87849221-87849243 CTCTAATTCTGCAGCTGTGAAGG + Intergenic
1194115229 X:89888558-89888580 ATCTTTTTCTTCATGTCAGAGGG + Intergenic
1194453306 X:94071740-94071762 CTCTAAGTCTTCAGATCAGATGG - Intergenic
1194773725 X:97937022-97937044 CTCTCTCTCTTCAGTTGAGCAGG - Intergenic
1195918608 X:109959975-109959997 CTCTATTCCTCCAAGTGAGCAGG + Intergenic
1200468020 Y:3545697-3545719 ATCTTTTTCTTCATGTCAGAGGG + Intergenic
1201594260 Y:15650318-15650340 CTCTATTTCCTCAGCTGATGGGG + Intergenic