ID: 1035007804

View in Genome Browser
Species Human (GRCh38)
Location 7:155681731-155681753
Sequence AAAGCTACTCCCATTGCAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 209}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035007804_1035007805 5 Left 1035007804 7:155681731-155681753 CCATTTGCAATGGGAGTAGCTTT 0: 1
1: 0
2: 2
3: 8
4: 209
Right 1035007805 7:155681759-155681781 TCTGTATTTACATCTTCATTCGG No data
1035007804_1035007806 8 Left 1035007804 7:155681731-155681753 CCATTTGCAATGGGAGTAGCTTT 0: 1
1: 0
2: 2
3: 8
4: 209
Right 1035007806 7:155681762-155681784 GTATTTACATCTTCATTCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035007804 Original CRISPR AAAGCTACTCCCATTGCAAA TGG (reversed) Intronic
900519949 1:3100660-3100682 AAAGCTCCTCCCTGGGCAAACGG - Intronic
900738243 1:4313819-4313841 GAAAATGCTCCCATTGCAAAAGG + Intergenic
905861492 1:41355014-41355036 ACAGCTATTCCCATTGCAGATGG - Intergenic
911669452 1:100591880-100591902 ACAGACATTCCCATTGCAAAAGG + Intergenic
911695791 1:100889632-100889654 AAAAATGCTCCCATTCCAAATGG + Intronic
916207379 1:162328427-162328449 AAGGCTACTCCTCTTCCAAATGG - Intronic
916209374 1:162347617-162347639 AGAGCAGCTCCCACTGCAAAAGG - Intronic
918493614 1:185109753-185109775 ATAGCCAATCCCATTCCAAAAGG + Intergenic
918956637 1:191217133-191217155 ATAAATACTCCCATTCCAAAAGG + Intergenic
921013747 1:211168563-211168585 GTAGGTACTCCCATTCCAAAAGG + Intergenic
923266651 1:232320860-232320882 AAAGCTACTCCCATCCCAACTGG - Intergenic
924475864 1:244381295-244381317 AAAGCTGTTCCCTTTGCATAAGG + Intronic
924906269 1:248456063-248456085 AAAACTAGTCCCACTGTAAAAGG + Intergenic
924921621 1:248635974-248635996 AAAACTAGTCCCACTGTAAAAGG - Intergenic
1063028582 10:2208321-2208343 ACAGCCACGCCCATTACAAAAGG + Intergenic
1064261030 10:13786621-13786643 AAATCTACATCCTTTGCAAAGGG + Intronic
1064917988 10:20483886-20483908 AAAGCCAGTCTCATTCCAAAGGG - Intergenic
1065716128 10:28570527-28570549 AGAGCTGCTCCTATTGCAACAGG - Intronic
1065772597 10:29091432-29091454 AAAGTTACTGCCAATGAAAATGG - Intergenic
1068270418 10:54716248-54716270 AGAGCTTCTCCCATTAAAAAAGG + Intronic
1068480849 10:57586204-57586226 AAAGCCACACCCATAGGAAAAGG + Intergenic
1068690825 10:59912089-59912111 AAAGCTACACCCACACCAAAAGG + Intergenic
1071460046 10:85884839-85884861 AATACTTCTCCCATTGAAAATGG - Intronic
1071905979 10:90173966-90173988 ATAGCAAATCACATTGCAAAAGG + Intergenic
1072463307 10:95640222-95640244 GAAGCTACTCATATTGAAAATGG - Intronic
1076136356 10:128047647-128047669 AAAGCTACTCCTGTTGCTCATGG - Intronic
1077400150 11:2351573-2351595 ATAGATATTTCCATTGCAAAAGG + Intergenic
1077836763 11:5933110-5933132 AAAGGTACTCCTATTGTCAATGG + Intronic
1078379621 11:10828703-10828725 ATAAATACTCCCATTCCAAATGG + Intronic
1080990474 11:37528899-37528921 AAATATACTCCCATTTTAAATGG + Intergenic
1081189171 11:40081758-40081780 AAAGACAATCCCATTTCAAAAGG - Intergenic
1081476186 11:43434115-43434137 AAAGCAACTACCATTGCTCATGG + Intronic
1084134970 11:67171122-67171144 TAAGCAATTCCCATTCCAAAAGG - Intronic
1090667391 11:128923824-128923846 AAAGCTCCACCGATTCCAAAGGG - Intergenic
1091219812 11:133923687-133923709 AAAGCTACAGCCTTTGGAAATGG + Intronic
1092455731 12:8640962-8640984 AAAGTTAATCCAGTTGCAAAAGG - Intronic
1092902906 12:13076368-13076390 AAAGCGCGTCCCATTCCAAAGGG + Intronic
1094126699 12:27031212-27031234 AAGGATACTCCCATTGAAATTGG - Intronic
1095201304 12:39387560-39387582 AAAGATACTCCATTTGGAAAGGG - Intronic
1098485982 12:71022306-71022328 AAAGCCACTGCCAGTTCAAATGG - Intergenic
1104218194 12:126755586-126755608 AAAGCTACTTCCATGGCAGAGGG - Intergenic
1104220331 12:126776440-126776462 CAAGCTCCTCCCACTGCATAAGG - Intergenic
1109192288 13:59339815-59339837 AAAACTAATACCAATGCAAAAGG + Intergenic
1109372839 13:61446546-61446568 AAAGTAAGTCACATTGCAAAGGG + Intergenic
1109462993 13:62687942-62687964 CAAGCTCCTCCCACTGCAAAGGG + Intergenic
1110355920 13:74567317-74567339 AAAGATAATTCCATTACAAAAGG + Intergenic
1110407949 13:75171428-75171450 AAAGCTTCTTCCATTTCAACGGG + Intergenic
1111051111 13:82884071-82884093 GTAGATACTCCCATTTCAAAAGG + Intergenic
1111578345 13:90189114-90189136 AAAGCTACTACCTTTGATAAGGG + Intergenic
1112716472 13:102191875-102191897 ATAGCCATTCCCATTCCAAAAGG + Intronic
1114185530 14:20398807-20398829 AATGCTGCTCCCTTTGTAAAGGG + Intronic
1117303086 14:54447399-54447421 ACAGGCACTCCCAGTGCAAAGGG - Intergenic
1118402733 14:65394659-65394681 ATAACTACACCCATTCCAAATGG + Intergenic
1119603601 14:75995341-75995363 GAACTTACTCCCATTCCAAAAGG - Intronic
1120364623 14:83549862-83549884 AAAGCTACTACATTTGCAATTGG + Intergenic
1122962472 14:105102109-105102131 AAAGCTACTCCTGTGTCAAATGG - Intergenic
1123696766 15:22884346-22884368 ATAAATGCTCCCATTGCAAATGG + Intronic
1125526913 15:40382442-40382464 AAAGCTACTCCCAATAAACAGGG - Intergenic
1126414106 15:48400050-48400072 TAAACTCCTCCCATTGCACAGGG - Intergenic
1127149260 15:56056750-56056772 AGAGATACTCCCATTCCCAAGGG + Intergenic
1127917229 15:63464786-63464808 AAACCTACTCCCAAGGCAGAAGG + Intergenic
1134226958 16:12398835-12398857 AAAGCTATCCCCTTTGCACAGGG + Intronic
1135754254 16:25083376-25083398 ACAGCAATTCCCATTCCAAAGGG - Intergenic
1136854069 16:33639199-33639221 AAACCTACTCCCACTGCCATTGG - Intergenic
1138136189 16:54525044-54525066 AAATATACTTCCATTACAAAAGG - Intergenic
1138904357 16:61312702-61312724 AAAACTAGTGCCCTTGCAAACGG - Intergenic
1203115646 16_KI270728v1_random:1487638-1487660 AAACCTACTCCCACTGCCATTGG - Intergenic
1148056822 17:44803575-44803597 AAAGCTACTTGTATTGGAAATGG - Exonic
1148905078 17:50906849-50906871 AGAGCTACTGCCAGTGGAAATGG + Intergenic
1151435310 17:74092103-74092125 AGAGACACTCCCATTCCAAAAGG + Intergenic
1152017784 17:77763047-77763069 AAAGCTTCTCCGATTGCAGTAGG - Intergenic
1153364980 18:4245931-4245953 AAAGCTTCTCCCATTCCATGAGG - Intronic
1156861157 18:41837756-41837778 AAAGTTACCCTCATTGCACAAGG - Intergenic
1156953144 18:42929773-42929795 GAAGCCAGTCCCATTGCAATGGG + Intronic
1157441806 18:47717334-47717356 AAAGCTAGGCCCATAGGAAAGGG - Intergenic
1159319428 18:66827911-66827933 AATTCTACTCCCCTTGAAAATGG - Intergenic
1159540182 18:69764821-69764843 AAAGCTACGACCTTTACAAATGG - Intronic
1164921688 19:32093253-32093275 GATGCTGGTCCCATTGCAAAGGG - Intergenic
1166237839 19:41469347-41469369 AAAATTACTCCCAATACAAAGGG - Intergenic
1166384162 19:42370888-42370910 AGAGCTACTCCCAGTGAGAAGGG - Intronic
928681324 2:33705664-33705686 AAAGCTACTAACTTTGCAGAGGG + Intergenic
928986841 2:37190514-37190536 AAAGCAACACCCATTTCATAAGG - Intronic
929023243 2:37575028-37575050 AAAGCAACTGCAATTGCAACTGG - Intergenic
929407707 2:41661509-41661531 AAAGCGATGCTCATTGCAAATGG + Intergenic
930621619 2:53649959-53649981 AAAGCTCGTCCCATTTAAAATGG + Intronic
930687619 2:54326031-54326053 ATAAATGCTCCCATTGCAAAAGG - Intergenic
930966284 2:57332194-57332216 ACAGCTACCCCCATTTCTAATGG - Intergenic
935378517 2:102424743-102424765 AAAGCAACAGGCATTGCAAAGGG + Intronic
936822648 2:116542151-116542173 ATAAATACTCCCATTCCAAATGG + Intergenic
937856203 2:126673580-126673602 AAAGCCACACCAATAGCAAATGG + Intronic
939201591 2:139042467-139042489 ATAGACACTCCCATTCCAAATGG - Intergenic
939201717 2:139044094-139044116 ATAGCCACTCCCATTCAAAAAGG - Intergenic
939242009 2:139573137-139573159 ATAGATATTCCCATTCCAAAAGG - Intergenic
939595873 2:144121550-144121572 AAAGACACTACCATTGCAATGGG + Intronic
942702557 2:178730092-178730114 AAAGCCACTCTCTTTGTAAAAGG - Exonic
943743770 2:191439647-191439669 CAGGCTTCTCCCATTTCAAAGGG + Intergenic
944905993 2:204262616-204262638 AAAGCTACACACATATCAAACGG - Intergenic
946297126 2:218794138-218794160 CAAGCTCCTCCCTCTGCAAACGG + Intronic
946625250 2:221604799-221604821 ACAGGTATTACCATTGCAAATGG - Intergenic
947375864 2:229494396-229494418 ATAGATATTCCCATTCCAAAAGG + Intronic
1169428273 20:5512854-5512876 AAAGCCACACCCAGTGCACATGG - Intergenic
1170043241 20:12060233-12060255 AAAGCAAGTCCCATGGCCAAGGG + Intergenic
1170267595 20:14485242-14485264 AAAACTACTCCCATTACTGATGG - Intronic
1170295857 20:14824729-14824751 AAATCTAGTCCCATGGCAATTGG + Intronic
1170890785 20:20373592-20373614 ATAGCTACTCACAGAGCAAAGGG - Intergenic
1170992009 20:21311431-21311453 AATGATACTCCCATTGTATATGG + Intronic
1174730100 20:52907664-52907686 AAAGCGGCTCCCCTTGCACATGG + Intergenic
1177188560 21:17824422-17824444 ATAAATACTTCCATTGCAAAAGG + Intergenic
1182506710 22:30788405-30788427 AAAGCTCCCCACGTTGCAAATGG - Intronic
949150874 3:765653-765675 ATAGATATTCCCATTCCAAAAGG - Intergenic
952091441 3:29891623-29891645 ACAGCAACTCCCAATGAAAAGGG - Intronic
954202866 3:49035071-49035093 AAAGCTTTTCCCATTGCCACTGG - Intronic
955105184 3:55891142-55891164 AAAGCCACACCCAATTCAAAGGG - Intronic
955833156 3:63026179-63026201 GTAGATGCTCCCATTGCAAAAGG + Intergenic
956681198 3:71783624-71783646 AAAGATACTTATATTGCAAAGGG + Intronic
957483095 3:80823651-80823673 ATAGATATTCCCATTCCAAAAGG - Intergenic
959327139 3:104951740-104951762 AAAGCTACCCCCCTTGTTAAAGG + Intergenic
959977744 3:112481040-112481062 ATAGATATTCCCATTCCAAAAGG + Intronic
960339202 3:116455057-116455079 AAAGTTACTCCCATTCTTAATGG + Intronic
960528420 3:118736611-118736633 AACTCTACACCCATTCCAAAAGG + Intergenic
960556065 3:119032228-119032250 AAAGCTGGTTCCATTACAAAGGG - Intronic
961020704 3:123503868-123503890 AAAACTATTAACATTGCAAATGG - Intronic
961338549 3:126200942-126200964 AAAGCTACAGCAATTACAAAAGG - Intergenic
962967089 3:140365357-140365379 GAAGATATTCCCATTTCAAAGGG + Intronic
962972602 3:140418077-140418099 AAAGATACTCCTCTTACAAAAGG - Intronic
963194381 3:142510132-142510154 AAAGCTACTGTCACTGAAAATGG + Intronic
963258609 3:143170943-143170965 AATGCTACACCCAGAGCAAAGGG + Intergenic
963264051 3:143221500-143221522 AAAGCCTCTGCCATTGCAACTGG - Intergenic
965707912 3:171528288-171528310 AAGGTTACTCTCATTACAAAAGG + Intergenic
966300715 3:178476678-178476700 CAAGCTACTCCCCTTGAAATAGG + Intronic
972449928 4:39186709-39186731 AAAACAAATCCCTTTGCAAATGG - Intronic
973096019 4:46200821-46200843 AAATCTATTCCCATTGCAAATGG - Intergenic
973639808 4:52891736-52891758 ACACTTAATCCCATTGCAAAAGG + Intronic
974198778 4:58611718-58611740 ACAGATACTCCCATTCCAAAAGG - Intergenic
975330332 4:73105488-73105510 AAAGCAACTCCAATGGGAAAAGG + Intronic
975413196 4:74079166-74079188 AAAGCTACAATCATGGCAAAAGG + Intergenic
976310062 4:83602565-83602587 AGACCTGCTGCCATTGCAAAGGG + Intronic
977802277 4:101249447-101249469 AAATTTTCACCCATTGCAAAAGG + Intronic
979173936 4:117637904-117637926 ATAGATATTCCCATTCCAAAGGG - Intergenic
981312135 4:143307683-143307705 AAAGCTCCACCCCTTGCACATGG + Intergenic
981422824 4:144570954-144570976 AAAGCTAGTCACAGTGCAAGAGG + Intergenic
982286984 4:153746181-153746203 ATAGATATTCCCATTCCAAAAGG + Intronic
982966691 4:161917817-161917839 ACAGCTACACCCATTGGGAAAGG - Intronic
983330049 4:166314958-166314980 AAAGCTTCTACCACTGAAAATGG - Intergenic
983572098 4:169220638-169220660 AAAGCTAATCCCATTGGAGCTGG - Intronic
983769915 4:171536342-171536364 ATAGATACTTCTATTGCAAAAGG - Intergenic
984571016 4:181393679-181393701 AAAGCAACTTTCAATGCAAAGGG + Intergenic
984717065 4:182935830-182935852 CAAGGTACTCCCAGAGCAAAAGG - Intergenic
985193237 4:187400480-187400502 AAATCCACTCAGATTGCAAAAGG - Intergenic
988216475 5:28280624-28280646 AAAGCAACTCTCTTTGAAAAAGG + Intergenic
988616405 5:32779292-32779314 AAAGCTATTCCCTTTTCAACTGG - Intronic
990125520 5:52512430-52512452 AAAGCTTTACCCATTGAAAAGGG + Intergenic
990167451 5:53010441-53010463 ATAGACACTCCCATTTCAAAAGG - Intronic
990373447 5:55144862-55144884 GAAGATCCTCCCATTCCAAAGGG - Intronic
992881806 5:81117826-81117848 ATAGATATTCCCATTGTAAAAGG + Intronic
993942389 5:94075449-94075471 AAAGCCATTCCCATTAAAAAGGG - Intronic
994005482 5:94832281-94832303 GAAGCTACTTCCATTGCCAAGGG + Intronic
995796253 5:115944749-115944771 AAAGCTATTCCCACAGTAAAAGG + Intergenic
998925993 5:147127268-147127290 ATAAATGCTCCCATTGCAAATGG + Intergenic
1001148375 5:169204586-169204608 AGAGGTAATCCCAGTGCAAAGGG + Intronic
1001879890 5:175234273-175234295 AAAACAACCCCCATTGCACAGGG + Intergenic
1001952551 5:175826393-175826415 AATGCTATTCCCAGTGCGAAAGG + Intronic
1002848101 6:966917-966939 AAAGCAACACCCATAGCAAAGGG + Intergenic
1004805638 6:19201295-19201317 ATAAATACTCCCATTTCAAATGG + Intergenic
1013362911 6:109411063-109411085 AAAGCTACTCCTAAGGGAAAAGG - Intronic
1013895955 6:115088419-115088441 AAATCTACACTCATGGCAAAGGG + Intergenic
1016300301 6:142623026-142623048 AAAGCTCCTCTCTTTGGAAAAGG + Intergenic
1018784275 6:167095971-167095993 ACAGCTCCTCCCATTGCAGGTGG + Intergenic
1020579113 7:9971824-9971846 GTAGGTACTCCCATTTCAAATGG - Intergenic
1021469366 7:20983912-20983934 AAAGTTACTCGCAATGTAAATGG + Intergenic
1021688386 7:23209841-23209863 AAAGCCTCTCACATTTCAAAGGG + Intergenic
1023269031 7:38439445-38439467 AAAGCTACAAACATAGCAAAAGG + Intronic
1026276943 7:68887985-68888007 AAAGCAACTGCCATGGGAAAAGG + Intergenic
1026501515 7:70946964-70946986 CAAGCTCCTTACATTGCAAAGGG - Intergenic
1027662716 7:81006295-81006317 AAAGTTACTTCCATTTTAAAAGG - Intergenic
1027663519 7:81016504-81016526 ATAGATATTCCCATTTCAAAAGG + Intergenic
1031021241 7:116630255-116630277 TAATCTACTCCCAAGGCAAATGG - Intergenic
1033121736 7:138672420-138672442 AAGGCCACTCCCATAGCTAAGGG + Intronic
1034521310 7:151622527-151622549 CAAGGTACTCCCAGTTCAAATGG + Intronic
1034945790 7:155260905-155260927 AAAGCCAGTCCCCTTCCAAAGGG - Intergenic
1035007804 7:155681731-155681753 AAAGCTACTCCCATTGCAAATGG - Intronic
1035618685 8:1022010-1022032 AAAGCCACTGGCCTTGCAAAGGG + Intergenic
1037131591 8:15413337-15413359 ATAGATATTCCCATTCCAAAAGG + Intergenic
1037415300 8:18643563-18643585 ATAGATGCTCCCATTCCAAAAGG + Intronic
1038252588 8:25919489-25919511 AAAGCTAAACACATTTCAAATGG - Intronic
1042190331 8:66179183-66179205 AGAGCTACTCCCATAGTGAAGGG + Intergenic
1042884042 8:73527868-73527890 AAATCTAGACCCTTTGCAAAAGG - Intronic
1044158647 8:88884048-88884070 TAAGCCACTCCCCCTGCAAATGG - Intergenic
1046146324 8:110164978-110165000 AAAGCCACTTCCACAGCAAATGG - Intergenic
1046200534 8:110921943-110921965 ATAAATACTCCCTTTGCAAAAGG - Intergenic
1046826106 8:118694175-118694197 GAAAATACTCCCATTCCAAAAGG + Intergenic
1047044707 8:121039020-121039042 AAGTCTACTCCCATTGCAAATGG + Intergenic
1050826177 9:9949548-9949570 AATGCTACTCACATACCAAAGGG + Intronic
1053200110 9:36146625-36146647 ATAGATACTCTCATTCCAAAAGG + Intronic
1055142616 9:72892841-72892863 AAAACAATTCCCATTGCAAGTGG + Intergenic
1055215622 9:73857653-73857675 AATTCTTCTCCCATTTCAAAAGG - Intergenic
1056037518 9:82622846-82622868 ATAGATATTCCCATTCCAAAAGG - Intergenic
1057969906 9:99544997-99545019 ATAGACATTCCCATTGCAAAAGG + Intergenic
1058513285 9:105742440-105742462 AAAGATATTGCCATTCCAAAAGG - Intronic
1058551771 9:106122691-106122713 AAAGATGCTCCCATTGCCCAGGG - Intergenic
1059598305 9:115747181-115747203 AAATGTACCCTCATTGCAAATGG + Intergenic
1185926995 X:4158319-4158341 AGAGTTACGCCCATTGGAAATGG + Intergenic
1186924916 X:14323003-14323025 AAGGCCACTCCAATTGCCAAGGG + Intergenic
1187146570 X:16642898-16642920 AACGCATCTTCCATTGCAAAAGG + Intronic
1190085588 X:47392750-47392772 ACAGATATTCCCATTCCAAAAGG + Intronic
1190146347 X:47894805-47894827 ATAGATATTCCCATTCCAAAAGG - Intronic
1190168583 X:48093379-48093401 GAAGTTTCTCTCATTGCAAAGGG - Intergenic
1190656762 X:52619547-52619569 ACAGATACTTCCATTTCAAATGG - Intergenic
1191964114 X:66737879-66737901 AAAGGTAATCCAATTGAAAAAGG - Intergenic
1192416444 X:70985179-70985201 AAATCTGCTCTCATTGCAATTGG - Intergenic
1193370810 X:80694731-80694753 ATAAATACTCCCATTCCAAATGG - Intronic
1194640138 X:96393859-96393881 AAAGTTACTGCAATTGCCAAAGG - Intergenic
1195197311 X:102511868-102511890 AAAGTTAGGCCCATTTCAAAGGG - Intergenic
1197223237 X:123932930-123932952 AAAAATACACCCATTCCAAATGG - Intergenic
1199291021 X:146105386-146105408 ATAAATACACCCATTGCAAATGG + Intergenic
1199689267 X:150295575-150295597 AAAACTACTATCATAGCAAAAGG - Intergenic
1199901585 X:152177985-152178007 AAATCTACTGCCCTTGCAAGTGG - Intronic
1200243714 X:154511621-154511643 ATAGATACTCCCACTGCAAAAGG - Intronic
1200250596 X:154551813-154551835 GCAGATACTCCCATTCCAAAGGG - Intronic
1200826223 Y:7645692-7645714 AAAGCAACTGCTATTTCAAAAGG - Intergenic