ID: 1035010407

View in Genome Browser
Species Human (GRCh38)
Location 7:155710809-155710831
Sequence GGGGGATGCAAGGCTGCTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035010399_1035010407 0 Left 1035010399 7:155710786-155710808 CCTTGCTTACCAGAGTTCCTGGA 0: 1
1: 0
2: 2
3: 29
4: 404
Right 1035010407 7:155710809-155710831 GGGGGATGCAAGGCTGCTACAGG No data
1035010397_1035010407 4 Left 1035010397 7:155710782-155710804 CCTGCCTTGCTTACCAGAGTTCC 0: 1
1: 0
2: 0
3: 18
4: 222
Right 1035010407 7:155710809-155710831 GGGGGATGCAAGGCTGCTACAGG No data
1035010404_1035010407 -9 Left 1035010404 7:155710795-155710817 CCAGAGTTCCTGGAGGGGGATGC 0: 1
1: 1
2: 2
3: 15
4: 200
Right 1035010407 7:155710809-155710831 GGGGGATGCAAGGCTGCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035010407 Original CRISPR GGGGGATGCAAGGCTGCTAC AGG Intronic
No off target data available for this crispr