ID: 1035011028

View in Genome Browser
Species Human (GRCh38)
Location 7:155714955-155714977
Sequence GCGGGTCACCACCAGGCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035011022_1035011028 17 Left 1035011022 7:155714915-155714937 CCCAGAGTGTAAGGGAGGGGGGC 0: 1
1: 0
2: 0
3: 26
4: 163
Right 1035011028 7:155714955-155714977 GCGGGTCACCACCAGGCCACTGG No data
1035011026_1035011028 -7 Left 1035011026 7:155714939-155714961 CCTCTTGACAGTGTCTGCGGGTC 0: 1
1: 0
2: 0
3: 6
4: 82
Right 1035011028 7:155714955-155714977 GCGGGTCACCACCAGGCCACTGG No data
1035011023_1035011028 16 Left 1035011023 7:155714916-155714938 CCAGAGTGTAAGGGAGGGGGGCG 0: 1
1: 0
2: 1
3: 19
4: 148
Right 1035011028 7:155714955-155714977 GCGGGTCACCACCAGGCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035011028 Original CRISPR GCGGGTCACCACCAGGCCAC TGG Intronic
No off target data available for this crispr