ID: 1035012732

View in Genome Browser
Species Human (GRCh38)
Location 7:155733962-155733984
Sequence TGCCAAGTCTGGAACCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 222}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035012732_1035012741 12 Left 1035012732 7:155733962-155733984 CCTCCCAGGTTCCAGACTTGGCA 0: 1
1: 0
2: 2
3: 15
4: 222
Right 1035012741 7:155733997-155734019 CCTCATGCCAGCTGTTCCTCGGG No data
1035012732_1035012739 11 Left 1035012732 7:155733962-155733984 CCTCCCAGGTTCCAGACTTGGCA 0: 1
1: 0
2: 2
3: 15
4: 222
Right 1035012739 7:155733996-155734018 ACCTCATGCCAGCTGTTCCTCGG No data
1035012732_1035012742 13 Left 1035012732 7:155733962-155733984 CCTCCCAGGTTCCAGACTTGGCA 0: 1
1: 0
2: 2
3: 15
4: 222
Right 1035012742 7:155733998-155734020 CTCATGCCAGCTGTTCCTCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035012732 Original CRISPR TGCCAAGTCTGGAACCTGGG AGG (reversed) Intronic
900231697 1:1562165-1562187 TCCCAGGTCTGGAACCCAGGAGG + Intronic
900401060 1:2473152-2473174 TCCCAAGGCTGGAACCGGGCGGG - Intronic
901889532 1:12250739-12250761 AGCCAGGTCTTGAACCTGGGTGG + Intronic
903497291 1:23778281-23778303 TACGAACTCTGGCACCTGGGAGG + Intergenic
904440364 1:30525859-30525881 TGCTATGTGTGGAAGCTGGGCGG - Intergenic
905042067 1:34968109-34968131 TGCCCAGTCTGGAAGGTGAGGGG - Intergenic
907942003 1:59096898-59096920 TGCCAAGTGTGAACCCTTGGTGG - Intergenic
912409289 1:109468434-109468456 TGCAAACTCTGGGACCTGGTGGG + Intronic
912529808 1:110312219-110312241 TGCCAAATCTGATACCTGAGTGG - Intergenic
915070622 1:153262501-153262523 TGCAAGGTCTGAAAGCTGGGTGG + Intergenic
916262572 1:162857046-162857068 TGTCAAATCTGGTAACTGGGTGG - Intronic
919034903 1:192294076-192294098 TGCCAATCTTGGAAACTGGGCGG + Intergenic
919648550 1:200122144-200122166 TGCCAAGACTGGATCCTGTGTGG + Intronic
922550258 1:226489440-226489462 TGGTAAGGCTGGAACCTGGGCGG + Intergenic
923091606 1:230745284-230745306 TGCAAAGTCTGGCACATGGAGGG - Intergenic
923742876 1:236672112-236672134 GGCCAAGTCAGGAACCTAAGAGG + Intergenic
1063134016 10:3200898-3200920 TGCCCAGCCTGGAGCCTGGGAGG + Intergenic
1063706961 10:8440042-8440064 TGGCAAGTCTGAAACCTGCAGGG + Intergenic
1064450818 10:15440660-15440682 AGCCAAGTCTGTATCCTGGGCGG - Intergenic
1067318736 10:45198157-45198179 GGCCAAGCCTGGAATCTGGAGGG - Intergenic
1068446752 10:57134893-57134915 TGCAAAGTATTGACCCTGGGTGG + Intergenic
1069949435 10:72008892-72008914 GGTGAAGTCTGGAATCTGGGTGG + Exonic
1070547953 10:77467461-77467483 TGCCATGTCTGGAACCCTGTTGG - Intronic
1071290030 10:84181959-84181981 TGGGAAGTCTGGAGCCTGAGAGG + Intronic
1071509172 10:86250584-86250606 TGCCCAGTCTGGGAGGTGGGGGG + Intronic
1071682851 10:87724932-87724954 TGGCAAGTCCGAAAACTGGGAGG + Intronic
1072309894 10:94144739-94144761 TGCCAAGTTTGAAGTCTGGGCGG + Intronic
1074946038 10:118281647-118281669 TGCCAAATCTGTAAAATGGGAGG - Intergenic
1075128741 10:119721842-119721864 TGCCCAGTCTGGAAAGTGAGGGG + Intergenic
1075272744 10:121067567-121067589 TCACAATTCTGGAAACTGGGAGG + Intergenic
1075699521 10:124460194-124460216 TGCCCAGTCTTGATCCTGGAAGG + Intergenic
1076211276 10:128646962-128646984 TGCCCTGTTTGGAACCTGGAGGG + Intergenic
1076904781 10:133356389-133356411 TGGCAGGTCAGGATCCTGGGCGG + Intronic
1076988825 11:258320-258342 TTCCAAGTCTGGACACAGGGTGG - Intergenic
1078012854 11:7586839-7586861 TGCCAGGTCTGGGCGCTGGGAGG - Intronic
1078078063 11:8179631-8179653 TGCCATGTCTTGAACCTGACTGG - Intergenic
1078341056 11:10498286-10498308 TGCAAAGCCAGGCACCTGGGAGG - Intronic
1079274202 11:19018577-19018599 TGCTAAGTCAAGAACCTGGGTGG - Intergenic
1080584065 11:33665904-33665926 TGCCCAGTCTTGTGCCTGGGAGG + Intronic
1082077827 11:47987996-47988018 TGCCATTTCTGAAACTTGGGCGG + Intronic
1082778047 11:57263148-57263170 TTCCAACTCAGGAACCTTGGTGG + Intergenic
1083340357 11:61955239-61955261 TGGCCTGTCTGGAGCCTGGGCGG - Intronic
1083892016 11:65600160-65600182 TGCCAAGCCAGGAAGCTGGTGGG - Intronic
1083961759 11:66018550-66018572 TGTCAAGTCTGGGCCCTGTGAGG - Intronic
1084195848 11:67523340-67523362 TGCCAGGCCTGGAACCCCGGGGG + Exonic
1084605478 11:70169465-70169487 TGCCAGGGCTGGGGCCTGGGAGG - Intronic
1085166831 11:74409194-74409216 TGGTAAGTCTTGAACTTGGGTGG + Intergenic
1085220158 11:74866950-74866972 TTCCAAATCTGGAGACTGGGTGG + Intronic
1087705288 11:101483552-101483574 TGCCAGGTATAGAACCTTGGTGG + Intronic
1088618599 11:111659319-111659341 AGCCATGTCTAGAACATGGGAGG - Intronic
1089315972 11:117591763-117591785 TGCCCATTCTGGAACGAGGGAGG + Intronic
1093146507 12:15573151-15573173 TGACAAGTCTGAAACCTGAAGGG + Intronic
1093414264 12:18902129-18902151 TTCCAAGTCTGGCAACTGTGCGG - Intergenic
1095414574 12:41962391-41962413 TGCCAAGTCTGGAACTCTGCGGG - Intergenic
1095507038 12:42908915-42908937 TGCCAAGTCTGCCTCCTGTGAGG + Intergenic
1097665260 12:62471100-62471122 TCCCAAGCCAGAAACCTGGGAGG - Intronic
1100367485 12:93935099-93935121 TGCTAAGTCTGGACCCTGGGTGG - Intergenic
1100764528 12:97849044-97849066 TGCCCAGTCTAGCCCCTGGGTGG - Intergenic
1101710171 12:107257485-107257507 TGCCTACCCTGGAATCTGGGGGG - Intergenic
1102663307 12:114548226-114548248 TTCTAATTCTTGAACCTGGGAGG - Intergenic
1103372973 12:120433475-120433497 GGCCAAGGCTCAAACCTGGGTGG + Intergenic
1103847076 12:123909043-123909065 CGCCTGGTCTGGAACCTGAGAGG + Intronic
1109456320 13:62596191-62596213 TGCCAAGTCTGGAAGATAGCTGG + Intergenic
1109852184 13:68079688-68079710 TTCCAAGTCTTGAACTTTGGAGG + Intergenic
1111050966 13:82882966-82882988 GGCCAAGTCTGAAACCTGGTGGG - Intergenic
1112449959 13:99499312-99499334 TGCCAAGAGTGGAAGCTGAGAGG + Intergenic
1114197057 14:20487735-20487757 TCCCAAGTCTGGAGCCTTTGGGG - Intergenic
1115328627 14:32169405-32169427 TGCCAAGCCTCCAGCCTGGGTGG - Intergenic
1117461682 14:55951612-55951634 TCCCATGTCTGGCACCTGGCTGG - Intergenic
1117528127 14:56632024-56632046 TACCCAGTCTGGAACCTGGGTGG + Intronic
1118220217 14:63848823-63848845 TGCCAAGCGTGGAGCCTGGTGGG - Intergenic
1118425059 14:65651309-65651331 AGGCCAGTCTGAAACCTGGGTGG - Intronic
1118901961 14:69993716-69993738 TGACAAGTCTGGGACCCTGGGGG + Intronic
1119619433 14:76120779-76120801 TGGCAAGTCTGAAACCTGTAGGG - Intergenic
1120503013 14:85320656-85320678 TGAGAAGTCTGGACACTGGGAGG - Intergenic
1121586032 14:95063734-95063756 TTCCAAGTTTGGAAGCTGGGTGG + Intergenic
1124155743 15:27224017-27224039 TGAGAAGCCTGGCACCTGGGTGG + Intronic
1126566672 15:50108286-50108308 GGCCAAGCCTGGAACAAGGGAGG - Intronic
1127221783 15:56887569-56887591 TGCTAAGCCTGCAGCCTGGGAGG + Intronic
1128393718 15:67201801-67201823 TTCCAAGCCTGTAACCTCGGAGG - Exonic
1128814266 15:70595630-70595652 TGACAAGACTGGACACTGGGTGG - Intergenic
1129052863 15:72797058-72797080 GGTCAAGTCTGGCGCCTGGGAGG + Intergenic
1129263576 15:74382290-74382312 CTCCAAATCTGAAACCTGGGAGG + Intergenic
1132422240 15:101680403-101680425 TGCCAAGTCTGGAATATATGTGG + Intronic
1132783536 16:1641885-1641907 TCCCCACTCTGGAGCCTGGGGGG + Intronic
1136008788 16:27348884-27348906 TGCCACGTCTTAAACCTGGCTGG - Intronic
1138607169 16:58096882-58096904 TGCCAAGGCTGGAAGCAGGCAGG + Intergenic
1140703021 16:77599981-77600003 TGGCCAGTCTGGATCCTGGAAGG - Intergenic
1142402750 16:89869467-89869489 TCCCCAGTCTGGGACCTGCGTGG - Intronic
1143728961 17:8869477-8869499 TGCTGAGTCTGGAACCTGCAGGG - Intergenic
1144464473 17:15486027-15486049 GGGCAAGTGTGGAACCAGGGAGG - Intronic
1144940037 17:18932579-18932601 TTCCAAATGTGGAAACTGGGTGG - Intergenic
1145418047 17:22741004-22741026 TGCCCAGTCTGGAAAGTGAGGGG + Intergenic
1147763236 17:42814854-42814876 TGCCAAAGCAGAAACCTGGGTGG + Intronic
1148536402 17:48442634-48442656 TGCCCAATCTGGAACCCTGGGGG + Intergenic
1151881858 17:76900583-76900605 TGCTACCTCTGGAAGCTGGGAGG + Intronic
1152993924 18:388738-388760 TGCCAGCTCTGGGACCTGGGTGG - Intronic
1153388072 18:4522235-4522257 TTCCAAATTTTGAACCTGGGAGG + Intergenic
1153929386 18:9865368-9865390 AGCCAAGTGTGTAACATGGGGGG - Intergenic
1154192608 18:12243280-12243302 GGCCAAGGCTGGCAGCTGGGAGG - Intergenic
1154952367 18:21222775-21222797 TGCCAAATCTGAAACCTGTAGGG + Intergenic
1155304250 18:24463693-24463715 GGCCAGTTCTGAAACCTGGGGGG - Intronic
1156526426 18:37771903-37771925 TGCCATCTCTGTAACCTAGGTGG - Intergenic
1157102182 18:44741276-44741298 TGCCAAGTCTGGCTGATGGGAGG + Intronic
1158045106 18:53146129-53146151 GGCTGAGTCTTGAACCTGGGAGG + Intronic
1160445841 18:78926218-78926240 TACCAGGTCTGGAAGCAGGGAGG + Intergenic
1162163772 19:8739137-8739159 GGCCAAGGCTGGCAGCTGGGAGG - Intergenic
1163413479 19:17171524-17171546 TGCAAAGTCTGTCCCCTGGGAGG - Intronic
1163822893 19:19506222-19506244 TGCTAAGTCTGGAAGGTGCGGGG - Exonic
1163829847 19:19542367-19542389 TGTCAAGGCTGCACCCTGGGGGG - Exonic
1164989209 19:32672662-32672684 AGCCAGGACTGGAACCAGGGCGG + Intronic
1165425419 19:35742777-35742799 TGGCCAGTATGGAACCTCGGGGG + Exonic
926777660 2:16438443-16438465 GGCCAAGTCTATAAACTGGGAGG + Intergenic
931226158 2:60333900-60333922 TGGCAAGTCAGAACCCTGGGGGG - Intergenic
935527304 2:104186607-104186629 TGGCCATTCTGGGACCTGGGTGG + Intergenic
937180123 2:119987823-119987845 TGGCTACTCTGGAGCCTGGGGGG - Intergenic
942649224 2:178149427-178149449 TGCCAGGTCTGCAAACCGGGAGG + Intergenic
943473829 2:188329870-188329892 TGCCAAGTTTAGCAACTGGGTGG + Intronic
946740595 2:222797257-222797279 TCTCAAGTGTGGAACCTAGGCGG - Intergenic
947911098 2:233801517-233801539 TGGCAAGTCTGACACCTGTGTGG + Intronic
947992092 2:234496375-234496397 TGCCACTTCTGGGACGTGGGCGG - Exonic
948524536 2:238562716-238562738 TGCCAGTTCTGGAAGCTGGGAGG - Intergenic
1168846568 20:949212-949234 TGTCAAGGGTGGAACCTGGCGGG - Intergenic
1169280137 20:4260183-4260205 TGCCAAGTCTGAAATCTGTAGGG + Intergenic
1170369087 20:15628720-15628742 TCCCAGGTCTGGCACCTTGGTGG + Intronic
1176193746 20:63826974-63826996 TGCCAGGTCTGGAACCGTGCGGG + Intronic
1176363554 21:6018563-6018585 TGGCACGACTGGAAGCTGGGAGG + Intergenic
1176664899 21:9677308-9677330 AGCCATGTCTGGAACATGGTAGG - Intergenic
1177184975 21:17783323-17783345 TGGCAAGTCTGAAACCTGCAGGG - Intergenic
1177811808 21:25932554-25932576 TGCCAAGACTGGAAAGTGTGGGG - Intronic
1178424650 21:32469632-32469654 TGGCAAGTCTGAAACCTGTAAGG + Intronic
1179759964 21:43519982-43520004 TGGCACGACTGGAAGCTGGGAGG - Intergenic
1179770519 21:43612007-43612029 TGGCCAGTCTGAGACCTGGGTGG - Intronic
1181037534 22:20177139-20177161 AGCCAGGCCTGGAGCCTGGGGGG + Intergenic
1181645083 22:24226570-24226592 TGCCAAGTCCTGAGCCAGGGAGG + Intronic
1182033049 22:27175091-27175113 CCCCAAGTCTGGGTCCTGGGTGG - Intergenic
1182381030 22:29888105-29888127 TCCCAAATCTTGAACCCGGGAGG - Intronic
1183185714 22:36290642-36290664 TGCCCAGTCTGGAAGGTGAGGGG + Intronic
1183219517 22:36503717-36503739 TGCCAAATCTGTGACCTCGGCGG - Intronic
1184871653 22:47244414-47244436 TACCAAGGCTGGGAGCTGGGTGG - Intergenic
1184909533 22:47518830-47518852 TGCCAATTCTGAAACTTGGGCGG - Intergenic
1184927564 22:47654000-47654022 TGCCAATGCAGGAAGCTGGGAGG + Intergenic
950015942 3:9754947-9754969 AGCCAAGCCTGGGAGCTGGGTGG + Intronic
950456762 3:13097340-13097362 AGCCACGTCTGGAAGCAGGGAGG - Intergenic
951291646 3:20877890-20877912 TGCAAAGTATTGATCCTGGGTGG + Intergenic
952443673 3:33359268-33359290 TTCCAAGCCTGGAAGGTGGGAGG - Exonic
954370368 3:50166882-50166904 GGCCAGGTCTGGAATGTGGGAGG + Intronic
955010227 3:55006655-55006677 CACCAAGTCTGAAATCTGGGTGG + Intronic
956251399 3:67237857-67237879 TGCCAAGTATGAAACCAAGGAGG - Intergenic
961959950 3:130844467-130844489 TGCCAATTCTGGAGCCTTTGGGG + Intergenic
966044032 3:175528511-175528533 TGCAAAGTGTTGATCCTGGGTGG - Intronic
966807080 3:183816138-183816160 TGCCAGGGCTAGCACCTGGGAGG + Exonic
967888965 3:194351500-194351522 TGCCAACCCTGCAACCTCGGTGG - Intergenic
969189474 4:5505413-5505435 TGACAAGTGTAGAAACTGGGAGG + Intergenic
969471860 4:7393878-7393900 AGCCAAGCGTGGAACCCGGGTGG + Intronic
970370983 4:15406222-15406244 TGCAAAGTGTGGATCCTGGCGGG - Intronic
971866921 4:32184353-32184375 TGCCAAGATTGGAACCCAGGTGG - Intergenic
972174438 4:36386199-36386221 AGCCAAGAAGGGAACCTGGGCGG + Intergenic
972495263 4:39628558-39628580 TCCCAAGTCAGCAACTTGGGAGG + Intronic
975028630 4:69584569-69584591 TGCCTCCTCTTGAACCTGGGGGG - Intergenic
977251492 4:94693896-94693918 TGGCAAGTCTGAAACCTGCAGGG - Intergenic
978564638 4:110069038-110069060 GGCTGAGGCTGGAACCTGGGAGG + Intronic
979439598 4:120735573-120735595 TGCCAGGTCTGGAGGCTGGATGG + Intronic
984102228 4:175499778-175499800 TTCCAAGTCCTGTACCTGGGAGG + Intergenic
984550405 4:181152665-181152687 TGCCAAGGGTGGAACCTGGTGGG - Intergenic
985410371 4:189677752-189677774 AGCCATGTCTGGAACATGGTAGG - Intergenic
986774524 5:11001914-11001936 TGCCACCTCTGGCCCCTGGGTGG + Intronic
986858021 5:11894172-11894194 TGCCGCGTCTGGCACCTGTGAGG - Intronic
991596053 5:68306928-68306950 TGCCAAGTCTCAAAGCTGTGGGG + Intergenic
995846484 5:116499388-116499410 TGCCATGGCTTGAACCTGGGCGG + Intronic
996444864 5:123535864-123535886 TGCCAAGTCTGAAACTAGGAGGG - Intronic
997206074 5:132050931-132050953 TGGCATGCCTGGAACCTGGGGGG + Intergenic
998132701 5:139659421-139659443 TCCCAAGCCTGGCAGCTGGGCGG + Intronic
999899754 5:156073885-156073907 TGACAGGTCTGAAACCTGAGAGG + Intronic
1000319138 5:160119652-160119674 TGTCAAGTGTGGAATCTGAGTGG + Intergenic
1001086879 5:168706991-168707013 TGGGAAGGCTGGAAGCTGGGCGG + Intronic
1001204721 5:169751800-169751822 TTCCATGTCTGGAACATGGTAGG - Intronic
1001363584 5:171113407-171113429 TTCCATGTCTGGAACATAGGAGG - Intronic
1001799724 5:174532497-174532519 TGCCTAGGCTGGAAACTGTGTGG - Intergenic
1002542857 5:179917628-179917650 TGCTAAGTCGGGACCCTGGCAGG - Intronic
1003082937 6:3037023-3037045 TCCCAACTCGGGAACCTCGGTGG + Intergenic
1004454154 6:15776031-15776053 TTCCATCACTGGAACCTGGGAGG + Intergenic
1004505650 6:16244702-16244724 TGCCAAGTGTTGTTCCTGGGAGG + Intronic
1005513744 6:26535309-26535331 TGGCAAGTCTGAAACCTGTAGGG - Intergenic
1007662993 6:43497788-43497810 TGCCCAGTCTGGGACCTGGAAGG - Intronic
1008681182 6:53874111-53874133 TGCCATGACTTGAACATGGGAGG + Intronic
1009882420 6:69584881-69584903 TGCCAAGGCTGAAACCTTGCAGG - Intergenic
1012398051 6:98822480-98822502 GGGCAGGTCTGGAACCTGTGTGG + Intergenic
1012418127 6:99031998-99032020 CACCAAGTCTAAAACCTGGGCGG + Intergenic
1012995426 6:105967936-105967958 TGCTATGTTTGGATCCTGGGGGG + Intergenic
1014301214 6:119683934-119683956 TGTCATGTCTGGAACCTCTGAGG - Intergenic
1014535730 6:122610893-122610915 TGCCAAGTCTTTCCCCTGGGCGG + Intronic
1015537649 6:134282800-134282822 TGGCAAGTCTGAAATCTGTGGGG - Intronic
1015923276 6:138286686-138286708 TGCCACGCCTGGAACATGGAGGG - Exonic
1017761812 6:157575024-157575046 TGGCAAGTCTGGAATCTGCAGGG + Intronic
1018882989 6:167903847-167903869 TGCCAGATTTGGGACCTGGGAGG - Intronic
1022484127 7:30764977-30764999 TGGCAAGTCTGAAACCTGCAAGG + Intronic
1026023356 7:66727522-66727544 TGCCAAGCCAGTGACCTGGGTGG + Intronic
1027184672 7:75963703-75963725 GGCCAAGTGTGGAGGCTGGGAGG + Intronic
1027854096 7:83486779-83486801 TGCCCAGACTGGCACCTGAGAGG + Intronic
1033476520 7:141698389-141698411 TGCTAACTCTGCAAGCTGGGTGG - Intronic
1033820285 7:145126527-145126549 TGCCAAGGGTGGAACCAGGTGGG + Intergenic
1033900350 7:146130954-146130976 TGCCAAGGGTGAAACCTGGTTGG - Intronic
1034789332 7:153953876-153953898 TGGCAAGTCTGAAATCTGGAGGG + Intronic
1034941196 7:155231527-155231549 TGCCGAGACGGAAACCTGGGAGG - Intergenic
1035012732 7:155733962-155733984 TGCCAAGTCTGGAACCTGGGAGG - Intronic
1035644689 8:1210150-1210172 AGCCTGGCCTGGAACCTGGGGGG - Intergenic
1042107545 8:65344802-65344824 TGGCAAGTCTGAAACCTGTAAGG + Intergenic
1042180987 8:66087687-66087709 AGACAAGTCTGAAACCTGGCTGG + Intronic
1042921684 8:73926211-73926233 TGGCAAGTCTGAAATCTGGTGGG - Intergenic
1051004453 9:12325835-12325857 TGCCAAGTATTGTTCCTGGGTGG - Intergenic
1051721500 9:20041939-20041961 TGCAGAGTCTGGCACCTGAGGGG - Intergenic
1052330562 9:27263437-27263459 TGCTAAGACTGAAACCTAGGGGG - Intergenic
1056534195 9:87513688-87513710 AGCCATGTCTGGAAATTGGGTGG + Intronic
1057840821 9:98484506-98484528 TGCCAAGTCTGGAAGGAAGGAGG + Intronic
1058954389 9:109931945-109931967 TGGCAGGTCGGGAAGCTGGGAGG - Exonic
1060087755 9:120716721-120716743 TGCCAACTCTGTGACCTTGGAGG + Intergenic
1060636637 9:125204489-125204511 GGACAATTCTTGAACCTGGGAGG + Intronic
1061464681 9:130768294-130768316 TGCTAGGTCTGTAACTTGGGAGG + Intronic
1062004465 9:134232236-134232258 TGTCAAGGCTGGAAACTGGAGGG - Intergenic
1203661202 Un_KI270753v1:44441-44463 AGCCATGTCTGGAACATGGTAGG + Intergenic
1203672387 Un_KI270755v1:27673-27695 AGCCATGTCTGGAACATGGTAGG + Intergenic
1185869848 X:3655398-3655420 TGCCACGTCCAGAACCTGCGGGG + Exonic
1186006602 X:5078898-5078920 TGCAAAGTATTGATCCTGGGTGG - Intergenic
1186468737 X:9804772-9804794 TGCCCAGTCTGGAGCCCTGGAGG + Intronic
1186510365 X:10125717-10125739 CCCCAAGTCTGGCACATGGGAGG - Intronic
1187369439 X:18692523-18692545 TGCCCAGTCTGAGACCTGTGGGG + Intronic
1188107332 X:26160532-26160554 TGGCAAGGCTGGCACCTGGACGG - Intergenic
1189225266 X:39407666-39407688 TCCCAAGCCTGTAACCTGGTAGG - Intergenic
1190458776 X:50650438-50650460 GGCCATCTCTTGAACCTGGGAGG - Intronic
1193050725 X:77096587-77096609 TTGCAAGTCTGAAACCTGGCTGG - Intergenic
1193772666 X:85605905-85605927 AGCCAAGCCTGGAACCAGAGTGG + Intergenic
1195708047 X:107752377-107752399 AACCAGGTCTGGAGCCTGGGTGG + Intronic
1198211561 X:134521256-134521278 TCCCAAGTCTGGAGGCTTGGTGG - Intergenic
1198520307 X:137445741-137445763 TGCCAGGTCTGGGACATGGCTGG + Intergenic
1199718955 X:150528198-150528220 TGGCAAGTCTGAAATCTGGAGGG - Intergenic
1202168221 Y:22014807-22014829 GGCCAATTCTGAAAGCTGGGTGG - Intergenic
1202223140 Y:22571561-22571583 GGCCAATTCTGAAAGCTGGGTGG + Intergenic
1202319975 Y:23624099-23624121 GGCCAATTCTGAAAGCTGGGTGG - Intergenic
1202550793 Y:26045957-26045979 GGCCAATTCTGAAAGCTGGGTGG + Intergenic