ID: 1035015614

View in Genome Browser
Species Human (GRCh38)
Location 7:155763293-155763315
Sequence ACGTATCCACAGGGGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 106}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035015614 Original CRISPR ACGTATCCACAGGGGGTGGA AGG Intronic
900396040 1:2453640-2453662 TCTGCTCCACAGGGGGTGGAAGG - Intronic
901879987 1:12188213-12188235 ACATACCCACAGGGGGTGGAAGG + Intronic
903296337 1:22345424-22345446 ACGGATGCACCAGGGGTGGATGG - Intergenic
904640010 1:31919038-31919060 AGATCTCCACAGGGGCTGGACGG + Exonic
905945399 1:41897458-41897480 ACGTGTCCTCAGATGGTGGAGGG - Intronic
906825145 1:48971368-48971390 ATTTTTCCACTGGGGGTGGAGGG - Intronic
908569357 1:65392603-65392625 CCACATCCTCAGGGGGTGGAGGG - Exonic
910411934 1:86955456-86955478 ATTTTTCCACAGGGGGTGGGCGG - Intronic
911035037 1:93533512-93533534 ACCTATCCTCAAGGGGAGGAGGG - Intronic
912920973 1:113866828-113866850 ACTTGACCCCAGGGGGTGGAGGG - Intronic
914944403 1:152051299-152051321 AGGAGTCCACAGGTGGTGGAAGG - Intergenic
918145964 1:181756066-181756088 CCGTCTCCACAGGGGAAGGATGG + Exonic
918879863 1:190103557-190103579 ACGTATACACAGAGGTTGCAAGG + Intronic
919105154 1:193140393-193140415 ACATATCCCCAGAGGGTGGATGG - Intronic
924034962 1:239926229-239926251 ACGTTTTCAAAGGGGCTGGAGGG + Intergenic
1080858197 11:36130369-36130391 ATGTGTCCACGGGGGCTGGAAGG + Intronic
1082675168 11:56090056-56090078 AGGTATCCACTGGGGGTCGTAGG - Intergenic
1082928249 11:58574124-58574146 ACGTCTCCACAGGCTGTTGATGG - Intronic
1083941622 11:65899438-65899460 ACGTGTCGACAGGGGAGGGAAGG - Intronic
1084385873 11:68842323-68842345 ACCGATCCACAGGGAGTGGTGGG + Intronic
1091118768 11:133039546-133039568 ACCCATGAACAGGGGGTGGATGG + Intronic
1091248826 11:134124300-134124322 AAATCTCCACAGGGGCTGGACGG + Intronic
1092030193 12:5277433-5277455 ACGGCTCCACAGTGGGTGGCGGG - Intergenic
1093656469 12:21700255-21700277 TGTTATCCACAAGGGGTGGAGGG - Intronic
1096750440 12:53755639-53755661 AAGTGTCCACAGGGGTGGGATGG + Intergenic
1099218993 12:79889872-79889894 ACGTATCCTCATATGGTGGAAGG + Intronic
1106518489 13:30475807-30475829 ACATTTCCACATGGGGAGGATGG + Intronic
1106901642 13:34360163-34360185 ACGTGTCCACAGGGGGTCATAGG + Intergenic
1113360777 13:109629380-109629402 ACGTAATCACAGGGGGAGAAAGG + Intergenic
1118380170 14:65211647-65211669 AGGTATCCACTGGGGGGGGGGGG + Intergenic
1119385501 14:74255737-74255759 AGGTATCCACACTGGGTGGGTGG + Intronic
1121798377 14:96754107-96754129 GAGTATACACAGGGTGTGGAAGG + Intergenic
1121821000 14:96966014-96966036 ACGTATGGACAGCGGGTGAAGGG + Intergenic
1124395324 15:29295483-29295505 ACGTATCCACTGGGGGTCTTAGG - Intronic
1124639638 15:31389498-31389520 ATGTAAACACAGGGGGAGGAGGG - Intronic
1126932426 15:53669368-53669390 ACTTAGCCCTAGGGGGTGGAGGG + Intronic
1133185089 16:4090180-4090202 AAGTATCCATAGGGCGTGGGGGG - Intronic
1138631216 16:58295551-58295573 ACGGAGCCACAGGGGGAGGGTGG + Intronic
1143573124 17:7773469-7773491 ACATATCCCCAGTGGGTGGGGGG - Intronic
1145741265 17:27276702-27276724 ACATATCCACAGGGGATGCTGGG - Intergenic
1147898611 17:43769102-43769124 GCCTATGCACAGGGTGTGGAAGG + Exonic
1153617411 18:6947564-6947586 ACGTGTCCACAGGGTGAGGCAGG - Intronic
1155240125 18:23856857-23856879 AGGTATCCAGATGGGGAGGAGGG - Intronic
1157367463 18:47078714-47078736 AGGTATTCACTGGGGGTAGAAGG - Intronic
1159590774 18:70332740-70332762 TTGTATCCACAGGTGGTGGTTGG - Intergenic
1159903016 18:74065885-74065907 AGGAATCCACAGTGGGTGAAGGG - Intergenic
1162254659 19:9479858-9479880 TGGTATCCACAGGTGGGGGAGGG + Intronic
1163612037 19:18306650-18306672 ACGTCTCCACAGAGGGGAGAGGG + Exonic
1164483408 19:28633358-28633380 ACCCATCCACAGGGGCTGAAAGG + Intergenic
925162780 2:1697721-1697743 ACGTCTCCCCAGGGGGCTGAGGG + Intronic
927939072 2:27092511-27092533 ATGTATCCACCCTGGGTGGATGG + Intronic
931193738 2:60029939-60029961 CCATATCCACACGGGGTGCAGGG - Intergenic
933024937 2:77244582-77244604 AAGTATCAGGAGGGGGTGGAGGG - Intronic
935964898 2:108463857-108463879 CCATATCCACAGGTGGTGCATGG + Intronic
940806026 2:158187355-158187377 ACTTATTCAAATGGGGTGGAGGG + Intronic
946067835 2:217004722-217004744 ACATATCCACAGAGAGTGGCTGG - Intergenic
946096279 2:217277224-217277246 CCGTATCCTCAGGTGGTGGAGGG + Intergenic
947853889 2:233310156-233310178 AGCTATCCACAGAGGCTGGACGG - Intronic
1170438481 20:16353802-16353824 AGGTATCCATATGGGGTGGAAGG + Intronic
1170861095 20:20104563-20104585 ACGTATCTACAGGGTGTGTTAGG + Intronic
1179250050 21:39664717-39664739 ACCCAGCCACAGGGGGTGGTGGG - Exonic
1179808686 21:43856242-43856264 ACGCCCCCACAGGGGCTGGAAGG + Intergenic
1180203858 21:46244801-46244823 ACGTACCCCCCAGGGGTGGAAGG + Exonic
1180801139 22:18632490-18632512 AGGGCTCCACAGAGGGTGGAAGG + Intergenic
1180852369 22:19028049-19028071 AGGGCTCCACAGAGGGTGGAAGG + Intergenic
1181220581 22:21362771-21362793 AGGGCTCCACAGAGGGTGGAAGG - Intergenic
1182351257 22:29701221-29701243 CTGTCTTCACAGGGGGTGGAAGG - Intergenic
949980848 3:9500892-9500914 ACGCCCCCACAGTGGGTGGAGGG + Exonic
956725418 3:72152707-72152729 ACCAATCCACAGGGGGTGAAGGG + Intergenic
964704247 3:159601518-159601540 AGGTATGCAGAGGGGGAGGAGGG + Intronic
965132377 3:164717571-164717593 ACATATTGACAGGCGGTGGAAGG - Intergenic
971041349 4:22755833-22755855 ACGTGTCCACAGTGGATGAATGG - Intergenic
975144345 4:70951251-70951273 ACTTTTCCACAGGGGTTGGCGGG - Intronic
976484061 4:85580101-85580123 ACACATACACAGGGTGTGGAGGG - Intronic
977121388 4:93106067-93106089 ACATAACAACAGGTGGTGGAAGG - Intronic
977605342 4:98978971-98978993 ATGTATCCTCACGTGGTGGAAGG + Intergenic
978518023 4:109589763-109589785 TTGTATCCTCAGGGGGTGGCAGG + Intronic
982152582 4:152477384-152477406 ACGTATTCAATGAGGGTGGAAGG - Intronic
984900936 4:184585845-184585867 AGTTTTCCACAGGGGGTGGAGGG - Intergenic
990148255 5:52787706-52787728 AAGTGTCCGCAGGGGATGGAAGG + Intergenic
999776742 5:154817991-154818013 ACTTTTCCACAGGGGGGTGAAGG + Intergenic
1001688529 5:173614789-173614811 ACGTATCCCCTGAGGGGGGAGGG - Intronic
1002174361 5:177393217-177393239 CCTTATCCTCAGGGGGTGTAAGG - Intronic
1005187065 6:23174510-23174532 ACGTAGCAGCAGGGGGTGGTGGG + Intergenic
1015717856 6:136210648-136210670 AAGTCTCCACAGCTGGTGGAAGG + Intergenic
1016409339 6:143765571-143765593 CTGGAGCCACAGGGGGTGGAGGG - Exonic
1023953474 7:44866880-44866902 GCGTAGCCTCAGAGGGTGGATGG + Intergenic
1029690519 7:102178286-102178308 AGCTAACCACAGGGGGAGGAAGG + Intronic
1032118187 7:129135268-129135290 ACTTATCTTCAGGGAGTGGATGG + Intergenic
1034982704 7:155488925-155488947 ACGTTTCCAAAGGGTGTGGCTGG - Intronic
1035015614 7:155763293-155763315 ACGTATCCACAGGGGGTGGAAGG + Intronic
1036768259 8:11562666-11562688 ACGTTTCCACCTGGGATGGAAGG - Intronic
1043863722 8:85352164-85352186 ACCTAACCTCAAGGGGTGGATGG + Intronic
1044307671 8:90656795-90656817 AGGACTGCACAGGGGGTGGAAGG + Intronic
1045848096 8:106660624-106660646 ACGCATCAAGAAGGGGTGGAGGG + Intronic
1046974845 8:120262880-120262902 AAGAATCCACTGTGGGTGGAGGG + Exonic
1047291149 8:123531582-123531604 ACGTATCCACAGGGTGGGCTCGG + Intronic
1047323901 8:123818170-123818192 ATGTGTCCTCACGGGGTGGAGGG + Intergenic
1047782741 8:128123231-128123253 ACCTCTCCATAGGGGGAGGAAGG - Intergenic
1048035425 8:130673112-130673134 AGCAATCCACAGGGGTTGGAAGG + Intergenic
1054556731 9:66664714-66664736 AAGTATCCACAGTGGCAGGATGG - Intergenic
1056640650 9:88367685-88367707 ATGTATGGACATGGGGTGGAAGG + Intergenic
1060015368 9:120081980-120082002 ATGTATTCACAGGGTGTTGAGGG + Intergenic
1060937514 9:127524233-127524255 AAGTGTCCACAGGGGGAGGGAGG + Intronic
1061918409 9:133769178-133769200 GCGTGTCCACAGGGGGTGGGTGG + Intronic
1062219093 9:135404705-135404727 ACAAATCCCCAGGGAGTGGAGGG - Intergenic
1062407287 9:136403066-136403088 GGGTTTCCACAGGGGGTGGGGGG + Intronic
1189553478 X:42117288-42117310 ATATATCCACAGGGGGTTGGGGG - Intergenic
1189633968 X:42985373-42985395 ACGTGCCCATAGTGGGTGGATGG + Intergenic
1195070059 X:101270458-101270480 ACCTATCTATAGGGGGTGGTGGG - Intronic
1195275470 X:103276420-103276442 AGGGATCCACAGGCTGTGGATGG + Intronic
1195780682 X:108460391-108460413 AAGTATCTTTAGGGGGTGGAGGG - Intronic
1195915256 X:109929111-109929133 ACATATCCACAGGGTGTCGTGGG - Intergenic
1197243716 X:124146925-124146947 AGGTAGCCACAGGATGTGGATGG + Intronic