ID: 1035018536

View in Genome Browser
Species Human (GRCh38)
Location 7:155787317-155787339
Sequence CTGGCTGCCCCGAGGGTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035018521_1035018536 17 Left 1035018521 7:155787277-155787299 CCTGCCGCTGGCTGCGTCCGAGC No data
Right 1035018536 7:155787317-155787339 CTGGCTGCCCCGAGGGTCCCAGG No data
1035018528_1035018536 0 Left 1035018528 7:155787294-155787316 CCGAGCAAGGGGTCCGGGCCCGC No data
Right 1035018536 7:155787317-155787339 CTGGCTGCCCCGAGGGTCCCAGG No data
1035018522_1035018536 13 Left 1035018522 7:155787281-155787303 CCGCTGGCTGCGTCCGAGCAAGG No data
Right 1035018536 7:155787317-155787339 CTGGCTGCCCCGAGGGTCCCAGG No data
1035018520_1035018536 25 Left 1035018520 7:155787269-155787291 CCGCGCGACCTGCCGCTGGCTGC No data
Right 1035018536 7:155787317-155787339 CTGGCTGCCCCGAGGGTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035018536 Original CRISPR CTGGCTGCCCCGAGGGTCCC AGG Intergenic
No off target data available for this crispr