ID: 1035018630

View in Genome Browser
Species Human (GRCh38)
Location 7:155787630-155787652
Sequence TGCTCGCTCCCACCAGGGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035018630_1035018643 4 Left 1035018630 7:155787630-155787652 CCCGTCCCTGGTGGGAGCGAGCA No data
Right 1035018643 7:155787657-155787679 GGCGGGTGAGGGGTGCGCCGCGG No data
1035018630_1035018649 30 Left 1035018630 7:155787630-155787652 CCCGTCCCTGGTGGGAGCGAGCA No data
Right 1035018649 7:155787683-155787705 GCTCTCCTGCCCCGCGGAGGAGG No data
1035018630_1035018641 -6 Left 1035018630 7:155787630-155787652 CCCGTCCCTGGTGGGAGCGAGCA No data
Right 1035018641 7:155787647-155787669 CGAGCACCGGGGCGGGTGAGGGG No data
1035018630_1035018648 27 Left 1035018630 7:155787630-155787652 CCCGTCCCTGGTGGGAGCGAGCA No data
Right 1035018648 7:155787680-155787702 GAGGCTCTCCTGCCCCGCGGAGG No data
1035018630_1035018647 24 Left 1035018630 7:155787630-155787652 CCCGTCCCTGGTGGGAGCGAGCA No data
Right 1035018647 7:155787677-155787699 CGGGAGGCTCTCCTGCCCCGCGG No data
1035018630_1035018645 8 Left 1035018630 7:155787630-155787652 CCCGTCCCTGGTGGGAGCGAGCA No data
Right 1035018645 7:155787661-155787683 GGTGAGGGGTGCGCCGCGGGAGG No data
1035018630_1035018644 5 Left 1035018630 7:155787630-155787652 CCCGTCCCTGGTGGGAGCGAGCA No data
Right 1035018644 7:155787658-155787680 GCGGGTGAGGGGTGCGCCGCGGG No data
1035018630_1035018640 -7 Left 1035018630 7:155787630-155787652 CCCGTCCCTGGTGGGAGCGAGCA No data
Right 1035018640 7:155787646-155787668 GCGAGCACCGGGGCGGGTGAGGG No data
1035018630_1035018639 -8 Left 1035018630 7:155787630-155787652 CCCGTCCCTGGTGGGAGCGAGCA No data
Right 1035018639 7:155787645-155787667 AGCGAGCACCGGGGCGGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035018630 Original CRISPR TGCTCGCTCCCACCAGGGAC GGG (reversed) Intergenic