ID: 1035018633

View in Genome Browser
Species Human (GRCh38)
Location 7:155787635-155787657
Sequence CCCGGTGCTCGCTCCCACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035018633_1035018644 0 Left 1035018633 7:155787635-155787657 CCCTGGTGGGAGCGAGCACCGGG No data
Right 1035018644 7:155787658-155787680 GCGGGTGAGGGGTGCGCCGCGGG No data
1035018633_1035018643 -1 Left 1035018633 7:155787635-155787657 CCCTGGTGGGAGCGAGCACCGGG No data
Right 1035018643 7:155787657-155787679 GGCGGGTGAGGGGTGCGCCGCGG No data
1035018633_1035018650 26 Left 1035018633 7:155787635-155787657 CCCTGGTGGGAGCGAGCACCGGG No data
Right 1035018650 7:155787684-155787706 CTCTCCTGCCCCGCGGAGGAGGG No data
1035018633_1035018647 19 Left 1035018633 7:155787635-155787657 CCCTGGTGGGAGCGAGCACCGGG No data
Right 1035018647 7:155787677-155787699 CGGGAGGCTCTCCTGCCCCGCGG No data
1035018633_1035018649 25 Left 1035018633 7:155787635-155787657 CCCTGGTGGGAGCGAGCACCGGG No data
Right 1035018649 7:155787683-155787705 GCTCTCCTGCCCCGCGGAGGAGG No data
1035018633_1035018648 22 Left 1035018633 7:155787635-155787657 CCCTGGTGGGAGCGAGCACCGGG No data
Right 1035018648 7:155787680-155787702 GAGGCTCTCCTGCCCCGCGGAGG No data
1035018633_1035018645 3 Left 1035018633 7:155787635-155787657 CCCTGGTGGGAGCGAGCACCGGG No data
Right 1035018645 7:155787661-155787683 GGTGAGGGGTGCGCCGCGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035018633 Original CRISPR CCCGGTGCTCGCTCCCACCA GGG (reversed) Intergenic