ID: 1035018642

View in Genome Browser
Species Human (GRCh38)
Location 7:155787653-155787675
Sequence GGCGCACCCCTCACCCGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035018642_1035018656 24 Left 1035018642 7:155787653-155787675 CCGGGGCGGGTGAGGGGTGCGCC No data
Right 1035018656 7:155787700-155787722 AGGAGGGTCAGAGAGAAAGAGGG No data
1035018642_1035018658 28 Left 1035018642 7:155787653-155787675 CCGGGGCGGGTGAGGGGTGCGCC No data
Right 1035018658 7:155787704-155787726 GGGTCAGAGAGAAAGAGGGAGGG No data
1035018642_1035018650 8 Left 1035018642 7:155787653-155787675 CCGGGGCGGGTGAGGGGTGCGCC No data
Right 1035018650 7:155787684-155787706 CTCTCCTGCCCCGCGGAGGAGGG No data
1035018642_1035018648 4 Left 1035018642 7:155787653-155787675 CCGGGGCGGGTGAGGGGTGCGCC No data
Right 1035018648 7:155787680-155787702 GAGGCTCTCCTGCCCCGCGGAGG No data
1035018642_1035018657 27 Left 1035018642 7:155787653-155787675 CCGGGGCGGGTGAGGGGTGCGCC No data
Right 1035018657 7:155787703-155787725 AGGGTCAGAGAGAAAGAGGGAGG No data
1035018642_1035018655 23 Left 1035018642 7:155787653-155787675 CCGGGGCGGGTGAGGGGTGCGCC No data
Right 1035018655 7:155787699-155787721 GAGGAGGGTCAGAGAGAAAGAGG No data
1035018642_1035018649 7 Left 1035018642 7:155787653-155787675 CCGGGGCGGGTGAGGGGTGCGCC No data
Right 1035018649 7:155787683-155787705 GCTCTCCTGCCCCGCGGAGGAGG No data
1035018642_1035018647 1 Left 1035018642 7:155787653-155787675 CCGGGGCGGGTGAGGGGTGCGCC No data
Right 1035018647 7:155787677-155787699 CGGGAGGCTCTCCTGCCCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035018642 Original CRISPR GGCGCACCCCTCACCCGCCC CGG (reversed) Intergenic