ID: 1035018648

View in Genome Browser
Species Human (GRCh38)
Location 7:155787680-155787702
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035018642_1035018648 4 Left 1035018642 7:155787653-155787675 CCGGGGCGGGTGAGGGGTGCGCC No data
Right 1035018648 7:155787680-155787702 GAGGCTCTCCTGCCCCGCGGAGG No data
1035018631_1035018648 26 Left 1035018631 7:155787631-155787653 CCGTCCCTGGTGGGAGCGAGCAC No data
Right 1035018648 7:155787680-155787702 GAGGCTCTCCTGCCCCGCGGAGG No data
1035018633_1035018648 22 Left 1035018633 7:155787635-155787657 CCCTGGTGGGAGCGAGCACCGGG No data
Right 1035018648 7:155787680-155787702 GAGGCTCTCCTGCCCCGCGGAGG No data
1035018630_1035018648 27 Left 1035018630 7:155787630-155787652 CCCGTCCCTGGTGGGAGCGAGCA No data
Right 1035018648 7:155787680-155787702 GAGGCTCTCCTGCCCCGCGGAGG No data
1035018635_1035018648 21 Left 1035018635 7:155787636-155787658 CCTGGTGGGAGCGAGCACCGGGG No data
Right 1035018648 7:155787680-155787702 GAGGCTCTCCTGCCCCGCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035018648 Original CRISPR GAGGCTCTCCTGCCCCGCGG AGG Intergenic