ID: 1035018736

View in Genome Browser
Species Human (GRCh38)
Location 7:155788107-155788129
Sequence AAGTGTGGGCCAGACACTCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035018736_1035018739 5 Left 1035018736 7:155788107-155788129 CCGCGAGTGTCTGGCCCACACTT No data
Right 1035018739 7:155788135-155788157 CTTAACCTCGCAATGTATTCAGG No data
1035018736_1035018741 15 Left 1035018736 7:155788107-155788129 CCGCGAGTGTCTGGCCCACACTT No data
Right 1035018741 7:155788145-155788167 CAATGTATTCAGGTTTCCCCAGG No data
1035018736_1035018742 18 Left 1035018736 7:155788107-155788129 CCGCGAGTGTCTGGCCCACACTT No data
Right 1035018742 7:155788148-155788170 TGTATTCAGGTTTCCCCAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035018736 Original CRISPR AAGTGTGGGCCAGACACTCG CGG (reversed) Intergenic