ID: 1035018738

View in Genome Browser
Species Human (GRCh38)
Location 7:155788122-155788144
Sequence CGAGGTTAAGAACAGAAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035018738_1035018742 3 Left 1035018738 7:155788122-155788144 CCACACTTCTGTTCTTAACCTCG No data
Right 1035018742 7:155788148-155788170 TGTATTCAGGTTTCCCCAGGCGG No data
1035018738_1035018739 -10 Left 1035018738 7:155788122-155788144 CCACACTTCTGTTCTTAACCTCG No data
Right 1035018739 7:155788135-155788157 CTTAACCTCGCAATGTATTCAGG No data
1035018738_1035018741 0 Left 1035018738 7:155788122-155788144 CCACACTTCTGTTCTTAACCTCG No data
Right 1035018741 7:155788145-155788167 CAATGTATTCAGGTTTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035018738 Original CRISPR CGAGGTTAAGAACAGAAGTG TGG (reversed) Intergenic