ID: 1035018739

View in Genome Browser
Species Human (GRCh38)
Location 7:155788135-155788157
Sequence CTTAACCTCGCAATGTATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035018736_1035018739 5 Left 1035018736 7:155788107-155788129 CCGCGAGTGTCTGGCCCACACTT No data
Right 1035018739 7:155788135-155788157 CTTAACCTCGCAATGTATTCAGG No data
1035018737_1035018739 -9 Left 1035018737 7:155788121-155788143 CCCACACTTCTGTTCTTAACCTC No data
Right 1035018739 7:155788135-155788157 CTTAACCTCGCAATGTATTCAGG No data
1035018734_1035018739 14 Left 1035018734 7:155788098-155788120 CCGTGGGAGCCGCGAGTGTCTGG No data
Right 1035018739 7:155788135-155788157 CTTAACCTCGCAATGTATTCAGG No data
1035018738_1035018739 -10 Left 1035018738 7:155788122-155788144 CCACACTTCTGTTCTTAACCTCG No data
Right 1035018739 7:155788135-155788157 CTTAACCTCGCAATGTATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035018739 Original CRISPR CTTAACCTCGCAATGTATTC AGG Intergenic