ID: 1035018741

View in Genome Browser
Species Human (GRCh38)
Location 7:155788145-155788167
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 141}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035018737_1035018741 1 Left 1035018737 7:155788121-155788143 CCCACACTTCTGTTCTTAACCTC No data
Right 1035018741 7:155788145-155788167 CAATGTATTCAGGTTTCCCCAGG 0: 1
1: 0
2: 1
3: 11
4: 141
1035018738_1035018741 0 Left 1035018738 7:155788122-155788144 CCACACTTCTGTTCTTAACCTCG No data
Right 1035018741 7:155788145-155788167 CAATGTATTCAGGTTTCCCCAGG 0: 1
1: 0
2: 1
3: 11
4: 141
1035018736_1035018741 15 Left 1035018736 7:155788107-155788129 CCGCGAGTGTCTGGCCCACACTT No data
Right 1035018741 7:155788145-155788167 CAATGTATTCAGGTTTCCCCAGG 0: 1
1: 0
2: 1
3: 11
4: 141
1035018734_1035018741 24 Left 1035018734 7:155788098-155788120 CCGTGGGAGCCGCGAGTGTCTGG No data
Right 1035018741 7:155788145-155788167 CAATGTATTCAGGTTTCCCCAGG 0: 1
1: 0
2: 1
3: 11
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035018741 Original CRISPR CAATGTATTCAGGTTTCCCC AGG Intergenic