ID: 1035018742

View in Genome Browser
Species Human (GRCh38)
Location 7:155788148-155788170
Sequence TGTATTCAGGTTTCCCCAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035018737_1035018742 4 Left 1035018737 7:155788121-155788143 CCCACACTTCTGTTCTTAACCTC No data
Right 1035018742 7:155788148-155788170 TGTATTCAGGTTTCCCCAGGCGG No data
1035018736_1035018742 18 Left 1035018736 7:155788107-155788129 CCGCGAGTGTCTGGCCCACACTT No data
Right 1035018742 7:155788148-155788170 TGTATTCAGGTTTCCCCAGGCGG No data
1035018738_1035018742 3 Left 1035018738 7:155788122-155788144 CCACACTTCTGTTCTTAACCTCG No data
Right 1035018742 7:155788148-155788170 TGTATTCAGGTTTCCCCAGGCGG No data
1035018734_1035018742 27 Left 1035018734 7:155788098-155788120 CCGTGGGAGCCGCGAGTGTCTGG No data
Right 1035018742 7:155788148-155788170 TGTATTCAGGTTTCCCCAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035018742 Original CRISPR TGTATTCAGGTTTCCCCAGG CGG Intergenic