ID: 1035019732

View in Genome Browser
Species Human (GRCh38)
Location 7:155793879-155793901
Sequence CTTGGCCTCCACCAAGGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035019732_1035019736 -8 Left 1035019732 7:155793879-155793901 CCTGCTCCTTGGTGGAGGCCAAG No data
Right 1035019736 7:155793894-155793916 AGGCCAAGGTCACAGGCTGCAGG No data
1035019732_1035019742 4 Left 1035019732 7:155793879-155793901 CCTGCTCCTTGGTGGAGGCCAAG No data
Right 1035019742 7:155793906-155793928 CAGGCTGCAGGAGGGGCAGGAGG No data
1035019732_1035019740 -3 Left 1035019732 7:155793879-155793901 CCTGCTCCTTGGTGGAGGCCAAG No data
Right 1035019740 7:155793899-155793921 AAGGTCACAGGCTGCAGGAGGGG No data
1035019732_1035019741 1 Left 1035019732 7:155793879-155793901 CCTGCTCCTTGGTGGAGGCCAAG No data
Right 1035019741 7:155793903-155793925 TCACAGGCTGCAGGAGGGGCAGG No data
1035019732_1035019738 -5 Left 1035019732 7:155793879-155793901 CCTGCTCCTTGGTGGAGGCCAAG No data
Right 1035019738 7:155793897-155793919 CCAAGGTCACAGGCTGCAGGAGG No data
1035019732_1035019739 -4 Left 1035019732 7:155793879-155793901 CCTGCTCCTTGGTGGAGGCCAAG No data
Right 1035019739 7:155793898-155793920 CAAGGTCACAGGCTGCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035019732 Original CRISPR CTTGGCCTCCACCAAGGAGC AGG (reversed) Intergenic
No off target data available for this crispr