ID: 1035019740

View in Genome Browser
Species Human (GRCh38)
Location 7:155793899-155793921
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035019725_1035019740 9 Left 1035019725 7:155793867-155793889 CCCAGGGACCCACCTGCTCCTTG No data
Right 1035019740 7:155793899-155793921 AAGGTCACAGGCTGCAGGAGGGG No data
1035019721_1035019740 28 Left 1035019721 7:155793848-155793870 CCAGTCTCTCTTGGGAGGCCCCA No data
Right 1035019740 7:155793899-155793921 AAGGTCACAGGCTGCAGGAGGGG No data
1035019724_1035019740 10 Left 1035019724 7:155793866-155793888 CCCCAGGGACCCACCTGCTCCTT No data
Right 1035019740 7:155793899-155793921 AAGGTCACAGGCTGCAGGAGGGG No data
1035019726_1035019740 8 Left 1035019726 7:155793868-155793890 CCAGGGACCCACCTGCTCCTTGG No data
Right 1035019740 7:155793899-155793921 AAGGTCACAGGCTGCAGGAGGGG No data
1035019734_1035019740 -9 Left 1035019734 7:155793885-155793907 CCTTGGTGGAGGCCAAGGTCACA No data
Right 1035019740 7:155793899-155793921 AAGGTCACAGGCTGCAGGAGGGG No data
1035019731_1035019740 0 Left 1035019731 7:155793876-155793898 CCACCTGCTCCTTGGTGGAGGCC No data
Right 1035019740 7:155793899-155793921 AAGGTCACAGGCTGCAGGAGGGG No data
1035019720_1035019740 29 Left 1035019720 7:155793847-155793869 CCCAGTCTCTCTTGGGAGGCCCC No data
Right 1035019740 7:155793899-155793921 AAGGTCACAGGCTGCAGGAGGGG No data
1035019732_1035019740 -3 Left 1035019732 7:155793879-155793901 CCTGCTCCTTGGTGGAGGCCAAG No data
Right 1035019740 7:155793899-155793921 AAGGTCACAGGCTGCAGGAGGGG No data
1035019730_1035019740 1 Left 1035019730 7:155793875-155793897 CCCACCTGCTCCTTGGTGGAGGC No data
Right 1035019740 7:155793899-155793921 AAGGTCACAGGCTGCAGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035019740 Original CRISPR AAGGTCACAGGCTGCAGGAG GGG Intergenic
No off target data available for this crispr