ID: 1035019741

View in Genome Browser
Species Human (GRCh38)
Location 7:155793903-155793925
Sequence TCACAGGCTGCAGGAGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035019731_1035019741 4 Left 1035019731 7:155793876-155793898 CCACCTGCTCCTTGGTGGAGGCC No data
Right 1035019741 7:155793903-155793925 TCACAGGCTGCAGGAGGGGCAGG No data
1035019734_1035019741 -5 Left 1035019734 7:155793885-155793907 CCTTGGTGGAGGCCAAGGTCACA No data
Right 1035019741 7:155793903-155793925 TCACAGGCTGCAGGAGGGGCAGG No data
1035019725_1035019741 13 Left 1035019725 7:155793867-155793889 CCCAGGGACCCACCTGCTCCTTG No data
Right 1035019741 7:155793903-155793925 TCACAGGCTGCAGGAGGGGCAGG No data
1035019724_1035019741 14 Left 1035019724 7:155793866-155793888 CCCCAGGGACCCACCTGCTCCTT No data
Right 1035019741 7:155793903-155793925 TCACAGGCTGCAGGAGGGGCAGG No data
1035019730_1035019741 5 Left 1035019730 7:155793875-155793897 CCCACCTGCTCCTTGGTGGAGGC No data
Right 1035019741 7:155793903-155793925 TCACAGGCTGCAGGAGGGGCAGG No data
1035019732_1035019741 1 Left 1035019732 7:155793879-155793901 CCTGCTCCTTGGTGGAGGCCAAG No data
Right 1035019741 7:155793903-155793925 TCACAGGCTGCAGGAGGGGCAGG No data
1035019726_1035019741 12 Left 1035019726 7:155793868-155793890 CCAGGGACCCACCTGCTCCTTGG No data
Right 1035019741 7:155793903-155793925 TCACAGGCTGCAGGAGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035019741 Original CRISPR TCACAGGCTGCAGGAGGGGC AGG Intergenic
No off target data available for this crispr