ID: 1035021256

View in Genome Browser
Species Human (GRCh38)
Location 7:155802159-155802181
Sequence TCACCATTTTGCCACATTCT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 193}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035021256_1035021261 20 Left 1035021256 7:155802159-155802181 CCAAGAATGTGGCAAAATGGTGA 0: 1
1: 0
2: 1
3: 13
4: 193
Right 1035021261 7:155802202-155802224 CATAAAGACAACAGAGGAGATGG 0: 1
1: 0
2: 2
3: 39
4: 461
1035021256_1035021259 14 Left 1035021256 7:155802159-155802181 CCAAGAATGTGGCAAAATGGTGA 0: 1
1: 0
2: 1
3: 13
4: 193
Right 1035021259 7:155802196-155802218 TGAAACCATAAAGACAACAGAGG 0: 1
1: 0
2: 0
3: 28
4: 364

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035021256 Original CRISPR TCACCATTTTGCCACATTCT TGG (reversed) Exonic
902132436 1:14274435-14274457 CCACCATTTTGCCATATCATGGG - Intergenic
911262801 1:95707248-95707270 TCAGCAGTTTTCCCCATTCTGGG + Intergenic
911738442 1:101362234-101362256 TCAGCATTGTGCCTCTTTCTTGG + Intergenic
915035158 1:152916784-152916806 TCAAAATTGTCCCACATTCTTGG + Intergenic
915864886 1:159488739-159488761 TCCCCATTTCTCCATATTCTTGG + Intergenic
916017399 1:160762294-160762316 TCGGCATTGTGCCACTTTCTTGG + Intergenic
916055070 1:161063199-161063221 TCAACATTGTGCCAGATGCTGGG - Intronic
916482401 1:165226341-165226363 TCAGCATTTTGCCTCAGTCCAGG - Intronic
917259326 1:173149894-173149916 TCAAAGTTTTGCCACTTTCTTGG + Intergenic
918933587 1:190890787-190890809 TCATCATTTTTCCAAATACTAGG + Intergenic
921585790 1:216944788-216944810 TCTCCATTTTACCTCACTCTTGG - Intronic
924854669 1:247864464-247864486 TTCCCATTTTGCCACAGGCTTGG - Intronic
1063781168 10:9327005-9327027 TCCCCATTTTTCTATATTCTGGG + Intergenic
1065623117 10:27603639-27603661 TCACCTGTTGGGCACATTCTCGG - Intergenic
1066482951 10:35814777-35814799 TCATCTTTTTGCCAGCTTCTAGG + Intergenic
1068140080 10:52995204-52995226 TCACTTTTTTGGCACATTCAAGG - Intergenic
1068390808 10:56394199-56394221 TTATAATTTTGCCACATTTTGGG - Intergenic
1071129390 10:82373703-82373725 TCATAATTTTGCCACAGTTTGGG + Intronic
1072474395 10:95745866-95745888 TGGCCATTCTGCCACATTCAAGG + Intronic
1078070547 11:8106452-8106474 TCACCATTTTTCCAGCCTCTGGG - Intronic
1085750007 11:79153586-79153608 CCACCATCATGCCACCTTCTAGG - Intronic
1085885611 11:80518292-80518314 TGACAATTTTTCCACATACTGGG - Intergenic
1088465525 11:110133119-110133141 TCAAGATATTGCCAAATTCTGGG + Intronic
1088596591 11:111445551-111445573 TAAGTATTTTGCCACATTCTAGG + Intronic
1090376225 11:126291626-126291648 TCCCCATTTAGCGACAATCTAGG + Intronic
1093641471 12:21531610-21531632 TCACCTTCCTTCCACATTCTTGG - Exonic
1094554213 12:31482180-31482202 TCATGATTGTGCCACATTTTGGG + Intronic
1095357987 12:41299123-41299145 TCTTCATTTTACAACATTCTAGG + Intronic
1099248791 12:80226638-80226660 TCACCAGTTTTCCTCTTTCTTGG + Intronic
1099379762 12:81939411-81939433 GCAGCATTTTGCCACACTCCTGG - Intergenic
1103159238 12:118713847-118713869 TCCCCCTTTTGCCGCCTTCTTGG + Intergenic
1103190357 12:118996081-118996103 TCACCATTTCCCCACATTTATGG + Intronic
1103606783 12:122092614-122092636 TCTCCATTTTGTGAAATTCTTGG + Intronic
1106245323 13:27944793-27944815 TCATCACATAGCCACATTCTGGG - Intergenic
1107311435 13:39082510-39082532 TTACCCTTTTGCCGCATGCTAGG - Intergenic
1107556334 13:41519444-41519466 TCTCCTTTATGCCACATGCTGGG + Intergenic
1107720891 13:43246804-43246826 CCACCTTATTGCCACATCCTTGG - Intronic
1108091168 13:46851632-46851654 TCTCCTTTTAGCAACATTCTGGG + Intronic
1108244325 13:48499581-48499603 TCAACATTTTGCCAAGTTTTTGG + Intronic
1108466859 13:50725354-50725376 GCACCACTTTGCCAGATTGTAGG + Intronic
1109248602 13:59989326-59989348 TCACAATTCTGACACAATCTTGG + Intronic
1109908256 13:68874452-68874474 TATCCCTTTTGCCATATTCTAGG - Intergenic
1118552640 14:66972566-66972588 GCCCCATTTTGTCACATTCAAGG + Intronic
1118552644 14:66972612-66972634 TTCCCATTTTGTCACATTCAAGG + Intronic
1120031924 14:79651428-79651450 TCACCATTGTGTCAGATGCTTGG + Intronic
1121232219 14:92366229-92366251 TCACCATTTTCCCAGAGGCTTGG - Intronic
1121440173 14:93943867-93943889 TCTCTATTTTGCCTTATTCTAGG + Exonic
1121987193 14:98518517-98518539 TCACCATAATGCCACATGGTAGG - Intergenic
1124820046 15:33035800-33035822 TCAAAATATTGCCACATTGTGGG - Intronic
1126523043 15:49618878-49618900 CTAACAGTTTGCCACATTCTAGG - Intronic
1128488977 15:68126855-68126877 TCACCATTATTCCACATTGAAGG + Intronic
1130065284 15:80597623-80597645 CCTCCATTTTGCCACTTTCAAGG - Exonic
1133324705 16:4935944-4935966 GGACCATTTTGCCAGCTTCTCGG - Intronic
1133615486 16:7472737-7472759 AAACAATTTTGCCACAGTCTGGG - Intronic
1139062074 16:63264224-63264246 TCACCATTTTTCCACAGTGGAGG + Intergenic
1139141694 16:64271299-64271321 GGACTACTTTGCCACATTCTTGG - Intergenic
1139871593 16:70112888-70112910 TGACCAATTTGAGACATTCTCGG - Intergenic
1140364342 16:74369598-74369620 TGACCAATTTGAGACATTCTCGG + Intergenic
1140606058 16:76539697-76539719 TCACAATTTTTCCCCACTCTAGG + Exonic
1145952238 17:28827969-28827991 ATACCATATTGCCAAATTCTTGG - Intronic
1147059587 17:37864590-37864612 TCAGCATTCTGGCACATTCAGGG + Intergenic
1149765782 17:59277015-59277037 TCACCATTTTGCATAACTCTAGG - Intergenic
1152780125 17:82223772-82223794 TCCCCACTTGACCACATTCTTGG + Intergenic
1159033929 18:63259182-63259204 GCAACATTTTGCCACATTACAGG - Intronic
1159522209 18:69540497-69540519 TTACCATTTGTCCACAATCTTGG + Intronic
1166963645 19:46514976-46514998 ACACCATTTGGCCCCATCCTGGG - Intronic
925004226 2:428743-428765 TCAGCATTTTGCCACCTTTTTGG + Intergenic
925982849 2:9191188-9191210 GGACCTTCTTGCCACATTCTGGG + Intergenic
928236238 2:29543718-29543740 AAACCTTTTTGGCACATTCTGGG + Intronic
930362081 2:50393915-50393937 TCTCCATGTTGCCATTTTCTAGG + Intronic
931134656 2:59384108-59384130 ACACCATTGTGCCACAATCACGG - Intergenic
932454470 2:71838870-71838892 TCACTTTTATGCCACCTTCTGGG - Intergenic
933134436 2:78714561-78714583 TCTCTATTTTACCATATTCTTGG - Intergenic
933541519 2:83649347-83649369 GCACCATTATGTCAGATTCTAGG + Intergenic
934094580 2:88587792-88587814 TCCCATTTTTGCCACATGCTAGG - Intronic
936759146 2:115753212-115753234 TAACCATCTTACCACAGTCTTGG - Exonic
937727627 2:125186354-125186376 TCACCCTTTTGCCATCTTATTGG + Intergenic
940593419 2:155759635-155759657 TCCCCATTTTTCCACTTTGTGGG + Intergenic
940713142 2:157186703-157186725 ACATTATTCTGCCACATTCTGGG - Intergenic
942734853 2:179097641-179097663 TCACCTTGTTGCCACTTTCAGGG + Intergenic
943726092 2:191253259-191253281 TCACCATTGTACCACGTTTTGGG + Intronic
945072401 2:206004729-206004751 TCTCCATTTAGCAACCTTCTCGG - Exonic
945126922 2:206522507-206522529 TCCAGTTTTTGCCACATTCTAGG - Intronic
945147443 2:206753093-206753115 TGACCATTCTGCCACCTTTTAGG + Intronic
945537628 2:211038481-211038503 TCATCATTTTACCAGAGTCTAGG - Intergenic
947110164 2:226709744-226709766 ACAGCGTTTGGCCACATTCTGGG + Intergenic
947467955 2:230370948-230370970 TACCCATTTTGCCACATGCTTGG - Exonic
1170092571 20:12607258-12607280 TCTCCATTTTGCTAAATACTTGG + Intergenic
1170101251 20:12701702-12701724 TCACCATATTTCCACCATCTAGG - Intergenic
1170112107 20:12816690-12816712 TCTCTATTTTGTCATATTCTAGG + Intergenic
1170941223 20:20849470-20849492 ACACCATTTTGCCTCTTTGTGGG - Intergenic
1171465787 20:25327027-25327049 GAACCACTTTGCAACATTCTGGG - Intronic
1174451380 20:50622874-50622896 TCTCCTTTGTGCCACATTTTGGG - Intronic
1175338486 20:58212172-58212194 TCACCATGTTGCCGAATTCCTGG - Intergenic
1175405033 20:58720291-58720313 TCAGCAATTTGCCACATGCAAGG + Intergenic
1175637840 20:60600459-60600481 TCAACAGTCTGCCACATTATAGG + Intergenic
1178628465 21:34238681-34238703 TTCACATTTTGCCACTTTCTTGG + Intergenic
1179834723 21:44022983-44023005 TCACCATTTTGCAACCTTTAGGG - Intronic
1181694019 22:24584094-24584116 ACCCCATTTTGCCTCACTCTGGG + Intronic
1184542848 22:45140983-45141005 TCACCATTTTAACACATTTTTGG - Intergenic
1184795878 22:46732043-46732065 TCCCCTTTTTGCCACAGACTGGG - Intronic
1184950168 22:47836018-47836040 GCACATTTTTGCCACATGCTGGG - Intergenic
949099337 3:125407-125429 TCACCTAAATGCCACATTCTCGG - Intergenic
950690277 3:14650668-14650690 TCACCATATACCCAGATTCTGGG + Intergenic
950755150 3:15164691-15164713 TGACCATCTTGCTTCATTCTAGG + Intergenic
956219403 3:66885713-66885735 CCACCATTTTGTCACCTTTTAGG + Intergenic
959441993 3:106388353-106388375 TCTCCTGTTTGCCAGATTCTGGG + Intergenic
961717584 3:128869272-128869294 TCACCATTTTGCCCAGTACTGGG + Intergenic
962669749 3:137693019-137693041 TCTCCAATCTGCCACAGTCTCGG + Intergenic
965678473 3:171224787-171224809 TCCCCATTTTGTCACAGTCTGGG - Intronic
966323752 3:178731334-178731356 TCACCATTTTCCAACATTTCGGG + Intronic
967148094 3:186623163-186623185 ACACCTTCTTGACACATTCTAGG + Intergenic
967960242 3:194914704-194914726 TCACCTTTTTGTCACTTTCCTGG + Intergenic
970338636 4:15081366-15081388 TCACCATGTTGGCACTTTTTTGG + Intergenic
970746698 4:19306738-19306760 TCACAATTTTGACAGATTGTTGG - Intergenic
971710931 4:30111634-30111656 TTCCCATTTTTCCACACTCTTGG - Intergenic
972946491 4:44263161-44263183 TCTTCATTTTGTCACATTATAGG + Intronic
975016183 4:69423849-69423871 TAACTATTTTGCCACATCTTTGG + Intergenic
976263765 4:83171167-83171189 CCACCATTTTGCCCCTTACTGGG + Intergenic
976385274 4:84449954-84449976 TAAACATTTCTCCACATTCTTGG - Intergenic
977886274 4:102255597-102255619 TCACCCATTTGCCACAAGCTGGG - Intronic
979536452 4:121826316-121826338 TGACCATTTTGACATAGTCTAGG + Intronic
980140063 4:128904752-128904774 TAACCATTTTGCCACATACTAGG - Intronic
980833719 4:138163579-138163601 TCTCCAGCTTTCCACATTCTCGG - Intergenic
982528859 4:156512224-156512246 TTTCCATTTGGCCACACTCTAGG - Intergenic
983608342 4:169615609-169615631 ACTCCATCTTGCTACATTCTAGG + Intronic
983903000 4:173156578-173156600 TCATCATTTTCCCACCTTCTAGG - Intergenic
987394242 5:17406836-17406858 TCCCCATATTGTCACAATCTGGG + Intergenic
989049160 5:37301775-37301797 TAACCATTTGGCTACAGTCTTGG - Intronic
990115480 5:52385089-52385111 TGTCCATTATGCCACTTTCTGGG - Intergenic
990392572 5:55341040-55341062 TCACCATTATACCATATCCTTGG - Intronic
991489646 5:67170167-67170189 TCACCATCTTCCCACACTCAGGG + Intergenic
993510769 5:88769234-88769256 TCATCATTTTCCCCCATTCTTGG + Intronic
993601355 5:89928856-89928878 TGACCATTCTGCCACATGTTTGG + Intergenic
995883156 5:116864967-116864989 TCCCCATTTTGCTCCATACTGGG + Intergenic
996217435 5:120886968-120886990 CCCCCATTTTGCCACACTGTGGG - Intergenic
996225647 5:120992029-120992051 TAATCATTTTTCTACATTCTTGG + Intergenic
997793007 5:136779447-136779469 GTACCATTTTAACACATTCTGGG + Intergenic
998570920 5:143256864-143256886 TCACAATTTTGCCACTTACCAGG + Intergenic
999431202 5:151526923-151526945 TCCCAAGTTTGCCACATTCCAGG + Intronic
1000461272 5:161521634-161521656 TAACATTTTTACCACATTCTGGG - Intronic
1000790466 5:165600790-165600812 TCATCATTTTGCAACAATCATGG - Intergenic
1004017988 6:11749714-11749736 TCTCCATGTTACCAAATTCTGGG - Intronic
1004160987 6:13212699-13212721 CCACCATTCTCGCACATTCTCGG + Intronic
1004876240 6:19957668-19957690 GCACCATGTTGCCACAGCCTAGG + Intergenic
1006258656 6:32850947-32850969 GTACCATTTTCCCACCTTCTTGG + Exonic
1006793530 6:36718318-36718340 TCTCCTTGTTGCCACAATCTAGG + Intronic
1008659760 6:53654425-53654447 TCAGCATCTTGCATCATTCTTGG + Exonic
1008842855 6:55925589-55925611 GCACTATTCTGCCATATTCTAGG + Intergenic
1009675729 6:66817698-66817720 TAACTATTTTGCCAATTTCTTGG + Intergenic
1011012832 6:82721515-82721537 TTCTCATTTTGCCACATACTAGG + Intergenic
1013551743 6:111214555-111214577 TCCACATTTAGCCAGATTCTGGG + Intronic
1014931001 6:127336024-127336046 ACATGATTTTGCAACATTCTAGG + Intronic
1016873216 6:148839079-148839101 TCCACATTTTGCCAGATTCCAGG - Intronic
1017434132 6:154399811-154399833 TCACCATTTTGACATATCTTGGG - Exonic
1018915175 6:168128573-168128595 TCCCCATTTTGCCCCACCCTGGG - Intergenic
1020993767 7:15235319-15235341 TCAAAATTTTGCAAAATTCTAGG - Intronic
1021679041 7:23110966-23110988 TAAACATTTTGCTAGATTCTGGG + Intronic
1021931819 7:25588598-25588620 TTGACATTTTACCACATTCTCGG + Intergenic
1023247990 7:38227045-38227067 TGCCCATTTTGCCACATTTTGGG + Intronic
1024148255 7:46539238-46539260 TTAGCATTTTGCCATATTTTAGG + Intergenic
1024426282 7:49230027-49230049 TCAGGCTTTGGCCACATTCTGGG - Intergenic
1026539894 7:71270480-71270502 GCACCATTTTGCCCCAGCCTGGG + Intronic
1028034170 7:85958939-85958961 TCATCGTTTTGCCATATTCTGGG + Intergenic
1028604608 7:92642269-92642291 TCAGCCTTTTGCCAGACTCTAGG + Intronic
1028806015 7:95026780-95026802 TCTCCAGATTCCCACATTCTGGG - Intronic
1028835019 7:95365402-95365424 CCTTCATTTTCCCACATTCTTGG - Intronic
1029205226 7:98865839-98865861 CCACCTTTCTGCCACATTTTGGG - Intronic
1030728668 7:112957514-112957536 TCTTCATTTTGCCATATTCAGGG + Intergenic
1031697290 7:124874092-124874114 TTTCCATTTTGCAAAATTCTAGG + Intronic
1031817586 7:126457432-126457454 TTACCAGATGGCCACATTCTGGG + Intronic
1031937648 7:127752110-127752132 TTTCCATTTTGTCACATCCTAGG + Intronic
1032272156 7:130419260-130419282 TCTCCTTTTTTCCCCATTCTTGG - Intronic
1033042807 7:137933687-137933709 TCACCACCTTGCTAAATTCTTGG - Intronic
1035008792 7:155692478-155692500 TCCCCATTGTGACACATTCAGGG + Intronic
1035021256 7:155802159-155802181 TCACCATTTTGCCACATTCTTGG - Exonic
1035469956 7:159103375-159103397 TTAAGATTTTGCCACATTCTGGG - Intronic
1037790708 8:21938502-21938524 TCACCATTTTTCTGCATTCAAGG + Intronic
1038342853 8:26702246-26702268 TTATCATTCTGCCACATTTTGGG + Intergenic
1038785742 8:30614277-30614299 TCACCATATTAAAACATTCTAGG + Intronic
1039958437 8:42225099-42225121 TCACTATTTTGCAACATAGTTGG + Intergenic
1041403842 8:57474168-57474190 TCTCCTTATGGCCACATTCTTGG + Intergenic
1041788152 8:61658956-61658978 TCATCACCTTGCCTCATTCTTGG - Intronic
1043330212 8:79107297-79107319 TTAGCAGTTTGCCACATTCCCGG + Intergenic
1043707986 8:83377718-83377740 TCTCCATCTTGCCACATTGTGGG - Intergenic
1047666926 8:127101638-127101660 TCAGCATTTTGCCTGGTTCTTGG - Intergenic
1047910912 8:129528183-129528205 TCACCATTTTGGGACCTTTTGGG + Intergenic
1049437230 8:142592333-142592355 TCCCCATTTTGCCCCCTTCCTGG + Intergenic
1051959425 9:22740023-22740045 TTCCCAGTTTGCCTCATTCTGGG - Intergenic
1052029969 9:23617423-23617445 TCAACATTTTGCCACTTGATAGG + Intergenic
1053363593 9:37507241-37507263 TCACCATTTTGCAACCATCTTGG - Intergenic
1056748176 9:89323339-89323361 TCACCCATCTGACACATTCTGGG - Intronic
1057362478 9:94387033-94387055 TTACTATTTTGCCCCATACTCGG + Intronic
1057848750 9:98547789-98547811 TCACCACTCAGCCACATTCCAGG - Intronic
1186707070 X:12152536-12152558 TCAACATTTTATCACATTTTAGG - Intronic
1187920592 X:24197678-24197700 TTACCATTTTGACAATTTCTTGG - Intronic
1188393592 X:29652501-29652523 TCCCCAATTTACCACTTTCTTGG - Intronic
1188757393 X:33979601-33979623 TCACATTTTTGTCACATTTTTGG - Intergenic
1192032956 X:67534190-67534212 TCATCATTTTTCAACATTCATGG - Intergenic
1192709221 X:73562765-73562787 TCATAACTTTGCCACAATCTTGG - Intergenic
1193964904 X:87973301-87973323 TCTCCATCTTACCACATTATTGG + Intergenic
1194207594 X:91030207-91030229 ACACCACTTGGCCACAATCTTGG + Intergenic
1194792820 X:98172024-98172046 TCACCATATTGTAACACTCTAGG + Intergenic
1197363624 X:125536754-125536776 TCACCCTTTTGCCACCTCCATGG + Intergenic
1197757821 X:130008614-130008636 TCACCTTCTTGCTACAGTCTAGG + Intronic
1199501922 X:148516506-148516528 TCACCATATTGGCATATACTTGG + Intronic
1200553392 Y:4605253-4605275 ACACCACTTGGCCACAATCTTGG + Intergenic
1201475388 Y:14376031-14376053 TCACCATTTTCCAAAATTCTTGG + Intergenic