ID: 1035022037

View in Genome Browser
Species Human (GRCh38)
Location 7:155805816-155805838
Sequence TAGGATCCACGGGCGCCCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035022024_1035022037 8 Left 1035022024 7:155805785-155805807 CCGCCCACCAGGCCTCTCCCCAA 0: 1
1: 6
2: 144
3: 1300
4: 5708
Right 1035022037 7:155805816-155805838 TAGGATCCACGGGCGCCCGGCGG No data
1035022022_1035022037 21 Left 1035022022 7:155805772-155805794 CCTGGGTTTACTGCCGCCCACCA 0: 1
1: 0
2: 2
3: 110
4: 660
Right 1035022037 7:155805816-155805838 TAGGATCCACGGGCGCCCGGCGG No data
1035022029_1035022037 -4 Left 1035022029 7:155805797-155805819 CCTCTCCCCAAAGGCAGCTTAGG 0: 1
1: 0
2: 0
3: 22
4: 211
Right 1035022037 7:155805816-155805838 TAGGATCCACGGGCGCCCGGCGG No data
1035022031_1035022037 -9 Left 1035022031 7:155805802-155805824 CCCCAAAGGCAGCTTAGGATCCA 0: 1
1: 0
2: 1
3: 12
4: 141
Right 1035022037 7:155805816-155805838 TAGGATCCACGGGCGCCCGGCGG No data
1035022020_1035022037 23 Left 1035022020 7:155805770-155805792 CCCCTGGGTTTACTGCCGCCCAC 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1035022037 7:155805816-155805838 TAGGATCCACGGGCGCCCGGCGG No data
1035022025_1035022037 5 Left 1035022025 7:155805788-155805810 CCCACCAGGCCTCTCCCCAAAGG 0: 1
1: 1
2: 3
3: 33
4: 492
Right 1035022037 7:155805816-155805838 TAGGATCCACGGGCGCCCGGCGG No data
1035022027_1035022037 4 Left 1035022027 7:155805789-155805811 CCACCAGGCCTCTCCCCAAAGGC 0: 1
1: 2
2: 4
3: 39
4: 608
Right 1035022037 7:155805816-155805838 TAGGATCCACGGGCGCCCGGCGG No data
1035022021_1035022037 22 Left 1035022021 7:155805771-155805793 CCCTGGGTTTACTGCCGCCCACC 0: 1
1: 0
2: 1
3: 5
4: 97
Right 1035022037 7:155805816-155805838 TAGGATCCACGGGCGCCCGGCGG No data
1035022032_1035022037 -10 Left 1035022032 7:155805803-155805825 CCCAAAGGCAGCTTAGGATCCAC 0: 1
1: 0
2: 1
3: 7
4: 77
Right 1035022037 7:155805816-155805838 TAGGATCCACGGGCGCCCGGCGG No data
1035022028_1035022037 1 Left 1035022028 7:155805792-155805814 CCAGGCCTCTCCCCAAAGGCAGC 0: 1
1: 0
2: 4
3: 52
4: 409
Right 1035022037 7:155805816-155805838 TAGGATCCACGGGCGCCCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035022037 Original CRISPR TAGGATCCACGGGCGCCCGG CGG Intronic
No off target data available for this crispr