ID: 1035022204

View in Genome Browser
Species Human (GRCh38)
Location 7:155806488-155806510
Sequence GTGGCCAGGAGTGAAACTGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 545
Summary {0: 1, 1: 0, 2: 4, 3: 55, 4: 485}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035022204_1035022209 -4 Left 1035022204 7:155806488-155806510 CCCGCAGTTTCACTCCTGGCCAC 0: 1
1: 0
2: 4
3: 55
4: 485
Right 1035022209 7:155806507-155806529 CCACTGGTTCATCACCGAGATGG 0: 1
1: 0
2: 0
3: 5
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035022204 Original CRISPR GTGGCCAGGAGTGAAACTGC GGG (reversed) Exonic
900430737 1:2602002-2602024 GTGGGTAGGAGTGGAATTGCTGG - Intronic
900830546 1:4962213-4962235 GAGGCCAGGAGAGAGCCTGCAGG + Intergenic
900900845 1:5514715-5514737 GTGGCCATTAGTGGAATTGCAGG - Intergenic
901774297 1:11549170-11549192 ATACCCAGGAGTGAAATTGCTGG - Intergenic
901880538 1:12191373-12191395 GCGGGGAGGAGCGAAACTGCTGG + Intronic
902201708 1:14838387-14838409 ATGGCTAGGAGTGAAATTGCTGG + Intronic
902252226 1:15161557-15161579 GCACCCAGAAGTGAAACTGCTGG - Intronic
902545668 1:17188578-17188600 GTGTCTAGGAGTGGAATTGCTGG + Intergenic
902896921 1:19485522-19485544 GTGCCCAGGAGTGAACATCCGGG + Intronic
903181745 1:21608403-21608425 GTGGCCAGGATTTGAACTGTGGG - Intronic
904196941 1:28792813-28792835 GTGGCCAGAGAAGAAACTGCAGG + Intergenic
904886528 1:33742662-33742684 GGGCCCAGGATTGAAACTGGAGG + Intronic
905665836 1:39762569-39762591 ATGGCCAAGAGAGAAACTGGGGG + Exonic
907490049 1:54803444-54803466 ATGCCCAGCAGTGAAATTGCTGG + Intergenic
907701758 1:56795490-56795512 GTTCCCAGAAGTGAAATTGCTGG + Intronic
908172421 1:61519044-61519066 ATTGCTAGGAGTGAAATTGCTGG + Intergenic
908287921 1:62629219-62629241 ATAGCTAGGAGTGAAATTGCTGG - Intronic
908750807 1:67421536-67421558 GTGCCCAGGAGCGAAACTGAGGG - Intronic
909614906 1:77596781-77596803 GTGGCCAGGATTGCCACTTCTGG + Intronic
909875329 1:80795581-80795603 CTGGCCAGGAGTGATGGTGCAGG + Intergenic
910047920 1:82939887-82939909 GTGGCCAGGAGAGAACGTGAGGG + Intergenic
911812412 1:102299732-102299754 GTACCCAGGAGTCAAATTGCTGG - Intergenic
912953835 1:114138876-114138898 GAGGCCAGGAATGAACATGCTGG - Intronic
913193741 1:116435156-116435178 TTGCCCAGGAGTGTAATTGCTGG + Intergenic
914918318 1:151831569-151831591 TTGGCAGGGAGTGAAACTGGAGG - Intronic
915103472 1:153516909-153516931 ATTCCCAGGAGTGAAACTGCTGG - Intergenic
915680931 1:157581543-157581565 GACGCCAGCAGTGAAACAGCAGG + Exonic
917607301 1:176645602-176645624 GTACCCAGTAGTGGAACTGCTGG + Intronic
917801493 1:178574711-178574733 GTACCCAAGAGTGAAATTGCTGG + Intergenic
917844882 1:179012210-179012232 ATTCCCAGGAGTAAAACTGCTGG - Intergenic
918488414 1:185054092-185054114 GTGTCTAGAAGTGAAACTGCCGG + Intronic
919420110 1:197359608-197359630 ATGCCCAGGAGTAAAATTGCTGG + Intronic
919829132 1:201527573-201527595 CTACCCAGGAGTGAAACTGATGG - Intergenic
920351849 1:205343162-205343184 GGGGCCAGGAGGGAAACAGATGG - Intronic
921017318 1:211204020-211204042 ATTCCCAAGAGTGAAACTGCTGG + Intergenic
921409439 1:214819398-214819420 ATGCCCAGAAGTGACACTGCTGG + Intergenic
921486758 1:215723913-215723935 ATGCCCAGTAGTGAGACTGCTGG - Intronic
923090641 1:230738207-230738229 ATACCCAGGAGTGAAACTGCTGG + Intergenic
923441933 1:234028773-234028795 GTGACCTGGTGTGAACCTGCAGG - Intronic
1063539941 10:6921967-6921989 ATGGCCAGAAGTGTAACTGTTGG + Intergenic
1064285066 10:13984876-13984898 TTACCCAGGAGTGAGACTGCTGG + Intronic
1065935181 10:30514962-30514984 GAGGCCAGGAGGGAAAGTGAAGG - Intergenic
1067239003 10:44474784-44474806 GTGGCCAGAAGAAGAACTGCTGG + Intergenic
1067481640 10:46603547-46603569 GTACCCAGGAGTGGAATTGCTGG - Intergenic
1067546728 10:47197182-47197204 GAAGCCAGGAGTGGAGCTGCGGG + Intergenic
1067613111 10:47738180-47738202 GTACCCAGGAGTGGAATTGCTGG + Intergenic
1067800846 10:49358511-49358533 ATACCTAGGAGTGAAACTGCTGG - Intergenic
1068681937 10:59829399-59829421 ATGCCAAGGAGTGAAATTGCTGG - Intronic
1068906336 10:62328166-62328188 ATATCTAGGAGTGAAACTGCTGG + Intergenic
1070921515 10:80189509-80189531 ATGCCCAGGAGTGAGATTGCTGG - Intronic
1071058527 10:81541081-81541103 ATACCCAGGAGTGAGACTGCTGG - Intergenic
1071070800 10:81691214-81691236 GTGACCAGGAGTAAAACTGCTGG + Intergenic
1071628525 10:87198286-87198308 GTACCCAGGAGTGGAATTGCTGG + Intergenic
1071930666 10:90466145-90466167 GTGGCCAGAGGTGAGGCTGCTGG - Intergenic
1072081846 10:92040681-92040703 ATGCCCAGGAGGGCAACTGCAGG - Intergenic
1072154312 10:92710196-92710218 ATGCCTAGGAGTGAAATTGCTGG + Intergenic
1072488667 10:95881515-95881537 ATGCCCAAGAGTGAAACTGTTGG + Intronic
1072622439 10:97089004-97089026 CTGCCCAGGAGTGCACCTGCAGG - Intronic
1073049219 10:100656774-100656796 CTGGCCTGGCGAGAAACTGCAGG + Intergenic
1073232283 10:101982237-101982259 TTGGCCAGGAGTGGTAGTGCAGG + Intronic
1073398026 10:103234386-103234408 GTGTCCAGAAGTGGAATTGCTGG - Intergenic
1073907827 10:108304482-108304504 GGGTCCAGAAGTGAAACTGGAGG + Intergenic
1074020397 10:109576648-109576670 GTGGCCATGGGTGAAAATGAGGG + Intergenic
1075334222 10:121597439-121597461 ATGGCCAGGGGTGGCACTGCTGG - Intronic
1075348505 10:121702772-121702794 GTCGCCAGAAGAGAAAGTGCAGG - Intergenic
1076024970 10:127103807-127103829 GTGGCCAGGAGTACAATGGCTGG + Intronic
1076817266 10:132921130-132921152 GTGGTCGGGAGTGGAGCTGCTGG - Intronic
1076885312 10:133259422-133259444 GTGGCAGGAAGTGAAGCTGCTGG + Intergenic
1077095082 11:795773-795795 GTGTCCATGAGTGAAACTCCTGG - Intronic
1077271175 11:1682343-1682365 ATGCCCAGGAGTGTGACTGCTGG - Intergenic
1077402093 11:2363994-2364016 ATGGCCAAGAGTGAAAGTGATGG + Intergenic
1079972152 11:27048716-27048738 ATGGCCAGTAATGATACTGCTGG + Intronic
1080009084 11:27439587-27439609 ATACCCAGGAGTGAAATTGCTGG + Intronic
1080493574 11:32794348-32794370 TTGGGCAGGATTGAGACTGCGGG - Intronic
1080506639 11:32920978-32921000 ATATCCAGGAGTGAAATTGCTGG - Intronic
1080534393 11:33207577-33207599 GGGCCCAGCAGTGAAATTGCTGG + Intergenic
1081226673 11:40532527-40532549 GTGGCCAGGATGGAAATTGTGGG + Intronic
1081798703 11:45841653-45841675 TATGCTAGGAGTGAAACTGCTGG + Intergenic
1082108249 11:48243685-48243707 GTGGCCTGGAGTGTTACTGTAGG + Intergenic
1082887759 11:58105976-58105998 ATGTCCAGGAGTGGGACTGCTGG + Intronic
1083040920 11:59686009-59686031 ATAGCCAGCAGTGAAACTGCTGG - Intergenic
1084375711 11:68775852-68775874 GTACCTAGGAGTGGAACTGCTGG - Intronic
1084379443 11:68801870-68801892 GTATCCAGGAGTGGAATTGCTGG - Intronic
1084657959 11:70530038-70530060 GTACCCAGGAGTGGAATTGCTGG - Intronic
1084959715 11:72710082-72710104 GTGCCCAGGAGGGAGACAGCAGG + Intronic
1085028938 11:73258068-73258090 ATGCCCAGGAGTGGAACTGTAGG - Intergenic
1085362691 11:75905818-75905840 GTACCTAGGAGTGAAATTGCTGG + Intronic
1086014598 11:82151580-82151602 ATAACTAGGAGTGAAACTGCAGG + Intergenic
1089594697 11:119570263-119570285 ATGCCTAGGAGTGGAACTGCTGG + Intergenic
1089626899 11:119756681-119756703 ATGCCCAGAAGTGAAATTGCTGG - Intergenic
1091499549 12:1002534-1002556 TTGGCCAGGAGTGAAAGTCCTGG + Intronic
1092231799 12:6779918-6779940 GTGAGTGGGAGTGAAACTGCTGG + Intergenic
1092405855 12:8221813-8221835 CTGACCTGGAGTGAGACTGCAGG - Exonic
1092577157 12:9798257-9798279 GTGGTCAGGAGGTAAAGTGCTGG + Intergenic
1092671261 12:10863745-10863767 ATAGCCAGAAGTGAAATTGCTGG - Intronic
1093390642 12:18615584-18615606 GTGCCCAGTAGTGAGATTGCTGG + Intronic
1094008640 12:25783107-25783129 GTGACCAGGAGGAAACCTGCAGG - Intergenic
1094366046 12:29682363-29682385 GTGCCCAGGAGTGCAACTGATGG - Intronic
1095354325 12:41253620-41253642 ATGCCCAGTAGTGAAATTGCTGG - Intronic
1095549295 12:43414804-43414826 GTAGCCAGGAGTTGAATTGCAGG - Intronic
1095570137 12:43675249-43675271 GTGGCCAGGGGACAATCTGCTGG + Intergenic
1095742463 12:45622031-45622053 GTAGCCAGGAGTGGCACTGCTGG - Intergenic
1096505070 12:52087514-52087536 GTGGCCAGGAGAGCAGCCGCTGG - Intergenic
1096778375 12:53977691-53977713 GTGGGCAGGAATGCAACTGAGGG + Intergenic
1096805028 12:54135472-54135494 GTGGCGAGGGGTGAAACTTGGGG + Intergenic
1097293376 12:57939244-57939266 GTAGCCAGTAGTGAGATTGCTGG - Intergenic
1097988377 12:65808265-65808287 ATGTCCAGGAGTGGAATTGCTGG + Intergenic
1098304507 12:69089175-69089197 ATTCCCAGGAGTGAAATTGCTGG + Intergenic
1099206657 12:79736329-79736351 ATGCCCAGGAGTGCAATTGCTGG - Intergenic
1099539299 12:83885907-83885929 GTGGGCAAGAGTGAAAGTTCAGG + Intergenic
1100051191 12:90449825-90449847 GTGCCCAGGAATGCAATTGCAGG + Intergenic
1101623869 12:106419189-106419211 CTTTCCAAGAGTGAAACTGCTGG + Intronic
1103780259 12:123393971-123393993 ATGCCTAGGAGTGAAATTGCTGG + Intronic
1103795100 12:123497898-123497920 GTGCCTAGGAGTGGAATTGCTGG + Intronic
1104002252 12:124867434-124867456 ATACCCAGGAGTGGAACTGCTGG - Intronic
1104181500 12:126386149-126386171 GTGGCCAGGCCTGCAAGTGCTGG - Intergenic
1104435277 12:128751089-128751111 ATACCTAGGAGTGAAACTGCTGG - Intergenic
1104748515 12:131224307-131224329 GGGGCCAGGTGTGAAACAGGAGG + Intergenic
1105491856 13:20895992-20896014 ATGGCCAGAAGTGAAATAGCTGG + Intronic
1105774701 13:23646789-23646811 ATACCCAGGAGTGAAATTGCTGG + Intronic
1105781187 13:23706294-23706316 GAGGCCTGGAGTGGAGCTGCTGG + Intergenic
1105981474 13:25520545-25520567 ATAGCCAGAAGTGAAATTGCTGG + Intronic
1106184091 13:27393400-27393422 ATGTCCAGGAGTGCAATTGCTGG - Intergenic
1107060054 13:36150548-36150570 GTACCCATGAGTGAGACTGCTGG - Intergenic
1107361888 13:39627131-39627153 ATGCCCAGAAGTGAAATTGCTGG + Intergenic
1107743678 13:43482121-43482143 GTACCCAGAAGTGAAATTGCTGG - Intronic
1108269242 13:48742577-48742599 ATGTCCAGGAGTTCAACTGCTGG + Intergenic
1109001749 13:56813490-56813512 GTCTGCAGGAGTGACACTGCAGG + Intergenic
1109646722 13:65268110-65268132 ATAGCCAGTAGTGGAACTGCTGG + Intergenic
1110466542 13:75808094-75808116 GGGGCCAGGGGTGAAACTGATGG - Exonic
1110553358 13:76831112-76831134 CTTGACAGGAGTGAAACTGTGGG - Intergenic
1114577920 14:23730131-23730153 GTGGACAGAAGTGGAACTGCAGG - Intergenic
1114947544 14:27703508-27703530 ATGTCTAGGAGTGAAATTGCTGG + Intergenic
1115660304 14:35487800-35487822 GTAGCTAGGAGTGGAATTGCTGG + Intergenic
1117084545 14:52185866-52185888 ATGGCCAGGAGTGTAACTGTTGG - Intergenic
1118382752 14:65230652-65230674 GAGGCCAGGGGTGTAACTGATGG - Intergenic
1118900967 14:69985375-69985397 ATGCTCAGGAGTGCAACTGCTGG - Intronic
1119708978 14:76807576-76807598 GAGGCCAGGTGGGAAGCTGCTGG + Intronic
1121007896 14:90501981-90502003 GTGGCCAGGGGTGATGATGCTGG - Intergenic
1121019386 14:90569866-90569888 GTGGCCAGGGGAGACTCTGCAGG + Intronic
1121141467 14:91546203-91546225 ATGCCCAGGAGTAAAATTGCTGG - Intergenic
1121192451 14:92042306-92042328 GTGGTAAGGAGTGATACTGTGGG + Exonic
1121266670 14:92607650-92607672 ATGCCCAAGAGTGAAATTGCTGG - Intronic
1121317937 14:92973390-92973412 GTGGCCAGGCGGGAGATTGCAGG - Intronic
1121337075 14:93083969-93083991 GTGTCCAGGAGGGAAATTGCCGG - Intronic
1121358443 14:93233791-93233813 GTGGAGAGGAGGGAAACTGAAGG - Intergenic
1122163984 14:99807503-99807525 GTGGCCAGGACTGGTACAGCAGG + Intronic
1122545485 14:102519617-102519639 GTACCTAGGAGTGGAACTGCTGG - Intergenic
1123131807 14:105993419-105993441 ATAGCCAGCAGTGAGACTGCTGG + Intergenic
1123582041 15:21724548-21724570 ATAGCCAGTAGTGAGACTGCTGG + Intergenic
1123618688 15:22167144-22167166 ATAGCCAGTAGTGAGACTGCTGG + Intergenic
1124011270 15:25840669-25840691 ATGCCCAGGAGTGCAACTGGTGG + Intronic
1124178068 15:27445211-27445233 TTGGCTAGAAGTGAAACTGCTGG + Intronic
1124389702 15:29242984-29243006 GTGCCCAGGAGTACCACTGCAGG + Intronic
1124448035 15:29756789-29756811 GGGGCCAGGATTAAAACTGTTGG - Intronic
1125030657 15:35072639-35072661 ATGTCCAGGAGTGCAATTGCTGG + Intergenic
1125767835 15:42146975-42146997 GGGGCCAGGAGTGTGACTCCAGG - Intronic
1125774596 15:42200682-42200704 GTAACCAGGAGTGGAATTGCTGG - Intronic
1126717259 15:51532002-51532024 GTGCCCAGCAGTGGAATTGCTGG - Intronic
1127920020 15:63486997-63487019 ATCCCCAGGAGTGCAACTGCTGG + Intergenic
1128255173 15:66191001-66191023 GCAGCCTGGAGAGAAACTGCTGG + Intronic
1128344682 15:66845972-66845994 GTAGCTAGGAGTGTACCTGCTGG - Intergenic
1128395950 15:67225881-67225903 ATAGCTAGGAGTGGAACTGCTGG + Intronic
1129308000 15:74682670-74682692 ATGACCAGAAGTGCAACTGCTGG - Intronic
1130515347 15:84622042-84622064 GTGGCAAAGAGTGAAAGTGAGGG + Exonic
1130896529 15:88174432-88174454 GAGGCCAGGAGGGAAGATGCTGG - Intronic
1131240745 15:90740593-90740615 ATAGCTAGGAGTGAAATTGCTGG + Intronic
1131248281 15:90814596-90814618 GTGGCCAGGAGTGGCAAAGCTGG - Intronic
1131328541 15:91472678-91472700 GTCCCCATGAGTGAAATTGCTGG + Intergenic
1131452803 15:92560103-92560125 ATTCCCAGGAGTGAAATTGCTGG - Intergenic
1131795740 15:96014639-96014661 GTGGCCATGTGGCAAACTGCTGG - Intergenic
1131974432 15:97929970-97929992 CTGGGTAGGACTGAAACTGCAGG + Intergenic
1132126971 15:99236149-99236171 ATGCCCAGAAGTGAAACTGCTGG + Intronic
1132435416 15:101797298-101797320 GTGCCCAGTAGTGGAATTGCTGG - Intergenic
1132494401 16:254380-254402 GTGACCAGGAGTTAAACTTTGGG + Exonic
1132767574 16:1542158-1542180 GTGGCCTGGGGGGAAGCTGCAGG + Intronic
1132838653 16:1967446-1967468 GAGGGCAGGAGTGAGACTGGGGG + Intronic
1133921607 16:10158399-10158421 ATACCCAAGAGTGAAACTGCTGG - Intronic
1134037564 16:11042413-11042435 GAGGACAGGAGGGAAGCTGCTGG + Intronic
1135290442 16:21232830-21232852 ATATCAAGGAGTGAAACTGCTGG - Intergenic
1135416482 16:22272160-22272182 ATGGCTATGAGTGAAACTGCTGG - Intronic
1135619249 16:23940319-23940341 ATGCCCAAGAGTGCAACTGCTGG - Intronic
1135733902 16:24915784-24915806 GTGGGCAGGAGGGAAACTAAGGG + Intergenic
1137255896 16:46775175-46775197 GTACCTAGGAGTGGAACTGCTGG - Intronic
1137468897 16:48736943-48736965 GTGGCCAGGACTGCAACTTGAGG + Intergenic
1138026488 16:53526221-53526243 ATGTCCAGGAGTGGAATTGCTGG - Intergenic
1138108331 16:54303784-54303806 GTCCCTAGGAGTGAAACCGCTGG + Intergenic
1138311878 16:56032116-56032138 ATGCCCAGGAGTGCAATTGCTGG + Intergenic
1138819402 16:60240747-60240769 GTAGCTAGGAATGAAACTGCTGG + Intergenic
1139399426 16:66668965-66668987 ATACCCAGGAGTGAAATTGCTGG - Intronic
1139593352 16:67945009-67945031 GTGCCCAGGAGAGAAGCCGCTGG + Intronic
1140503715 16:75456604-75456626 GCGGCTAGAAGAGAAACTGCAGG - Intronic
1140582463 16:76247886-76247908 ATGCCCAGTAGTGGAACTGCTGG - Intergenic
1140979920 16:80098122-80098144 TATACCAGGAGTGAAACTGCTGG + Intergenic
1141672384 16:85499073-85499095 GTGCAGAGGAGTGAGACTGCAGG + Intergenic
1141782194 16:86170230-86170252 ATGCTCAGGAGTGTAACTGCAGG + Intergenic
1141849264 16:86633332-86633354 ATACGCAGGAGTGAAACTGCTGG + Intergenic
1142892624 17:2954453-2954475 GTGTCTAGGAGTGGCACTGCTGG + Intronic
1144672449 17:17140609-17140631 GTGCCCAGGAGCCAGACTGCTGG + Intronic
1145199224 17:20926087-20926109 GTGTCCAGAAGTGGAATTGCTGG + Intergenic
1145253760 17:21311496-21311518 TTGTCTAGGAGGGAAACTGCTGG + Intronic
1145322828 17:21776465-21776487 TTGTCTAGGAGGGAAACTGCTGG - Intergenic
1145822883 17:27853405-27853427 TTCTCCAGGAGTGAAATTGCTGG + Intronic
1146159675 17:30553172-30553194 GTGGACACCATTGAAACTGCCGG + Intergenic
1146413329 17:32608629-32608651 GTGCCTAGGAGTGAGATTGCTGG - Intronic
1146477486 17:33174644-33174666 ATGGCCAGAAGTCACACTGCAGG - Intronic
1147279937 17:39350864-39350886 GTGGGCAGGAGAGAAAATGGTGG + Intronic
1147426142 17:40346769-40346791 GAGGTCAGGAGAGAATCTGCTGG + Intronic
1148086119 17:44994866-44994888 TTGGCCAGTGGTGAAGCTGCTGG + Intergenic
1148274479 17:46291369-46291391 GTGAGCAGGACTAAAACTGCAGG + Intronic
1148958693 17:51374957-51374979 GAAGCCAGGAGTGGAATTGCAGG + Intergenic
1150361190 17:64535721-64535743 ATAGCTAGGAGTGAAATTGCTGG - Intronic
1150408576 17:64923186-64923208 GTGAGCAGGACTAAAACTGCAGG - Intergenic
1150760211 17:67954589-67954611 GTGAGCAGGACTAAAACTGCAGG - Intronic
1150893734 17:69184684-69184706 ATGCCCAGGAGTGGAATTGCTGG - Intronic
1152911374 17:83006844-83006866 ATGCCCAGGAGAGCAACTGCCGG + Intronic
1154132721 18:11750771-11750793 GTGGGCAGGAGGAAAACTGGTGG + Intronic
1154262123 18:12844293-12844315 ATGCCCAGGAGTGCAAGTGCTGG + Intronic
1155594222 18:27465010-27465032 GTGCCTAGGAGTGGAATTGCCGG - Intergenic
1155805238 18:30162777-30162799 GTGGCCAGCAGAGAAATTTCAGG - Intergenic
1155861208 18:30902209-30902231 ATGCCCAGTAGTGAAATTGCTGG + Intergenic
1156790835 18:40971771-40971793 ATACCCAGGAGTGATACTGCTGG + Intergenic
1158343676 18:56492963-56492985 ATATCCAGGAGTGAAATTGCTGG + Intergenic
1158368964 18:56775326-56775348 GTAGCCAGGAGTAAATTTGCAGG - Intronic
1158866323 18:61640942-61640964 GTGGGCAGGAGGGAAACCACTGG - Intergenic
1160137002 18:76280877-76280899 ATGCCCAGGAGTGTGACTGCTGG + Intergenic
1160206598 18:76839237-76839259 GTACCTAGGAGTGGAACTGCTGG + Intronic
1161490536 19:4558519-4558541 GTGGCCACGAGCGGGACTGCAGG - Intronic
1161559033 19:4960595-4960617 GTGGCCAGGAGCAAACCTGATGG + Intronic
1161853678 19:6752110-6752132 GTGGCCAGGAATGAGACCCCAGG - Intergenic
1162488827 19:10979233-10979255 GTGTCCAAGAATGAAACTGGTGG - Intronic
1162938742 19:13995482-13995504 GTGGCCAGGGGTGACAGGGCTGG + Intronic
1165359100 19:35323353-35323375 ATGCCCAGGAGTGCAATTGCTGG + Intronic
1166235147 19:41450359-41450381 ATGCCCAGGAGGGGAACTGCTGG - Intergenic
1168495812 19:56849131-56849153 GTAGCCAGAAGTGAGATTGCTGG + Intergenic
925027829 2:623540-623562 GGGGCCAGGAGCAACACTGCAGG + Intergenic
925208357 2:2026364-2026386 GTGCCCAGGAGGGAGACTGGAGG + Intronic
925725643 2:6868043-6868065 GTGGAAAGGAGAGAAGCTGCAGG + Intronic
925978681 2:9159125-9159147 ATGCCCAGGAGTGCAATTGCTGG + Intergenic
926273468 2:11385785-11385807 GTGCCTGGGAGTGAAATTGCTGG + Intergenic
926442553 2:12905526-12905548 GTACCCAGGAGTGTGACTGCTGG + Intergenic
926635390 2:15173627-15173649 CATGCCAGGAGTGAAACTGATGG - Intronic
927890421 2:26744607-26744629 GAAGCCAGCATTGAAACTGCTGG - Intergenic
928704633 2:33934871-33934893 ATGGCCAGCAGTGGTACTGCTGG + Intergenic
929722032 2:44379422-44379444 GTACCCAGGAGTGGAATTGCTGG + Intronic
929842591 2:45485092-45485114 ATGCCTAGGAGTGAAATTGCTGG + Intronic
929967002 2:46543333-46543355 GTTGCCAGGAGCGAAGCTTCGGG - Intronic
930101809 2:47609185-47609207 ATGGCCAGGAAAGAAACTGTTGG - Intergenic
930182731 2:48380426-48380448 GTGCCCAGAAGTAAATCTGCTGG - Intergenic
931646508 2:64426657-64426679 ATGCCCAGGAGTAGAACTGCTGG + Intergenic
931681986 2:64758524-64758546 ATTCCCAGGAGTGGAACTGCTGG - Intergenic
932048485 2:68375045-68375067 TTGCCCAGGAGTGAAATTGCTGG + Intronic
932926800 2:75985461-75985483 ATACCCAGGAGTGGAACTGCTGG + Intergenic
933569885 2:83997678-83997700 ATGCCTAGGAGTGAAATTGCTGG + Intergenic
934653490 2:96105288-96105310 GTTGCCAGGATGGGAACTGCAGG + Intergenic
934863538 2:97785646-97785668 GTGCCCAGGAGTGAATTTGTTGG - Intronic
936474539 2:112828369-112828391 ATCTCCAGGAGTGAAATTGCTGG + Intergenic
937878679 2:126848765-126848787 ATGCCCAGGAGTGGAATTGCAGG - Intergenic
938181676 2:129190232-129190254 GTATCCAGGAGTGGAACTGTTGG - Intergenic
939481922 2:142759834-142759856 ATACCCAGTAGTGAAACTGCTGG - Intergenic
940050888 2:149463512-149463534 GTGACCAGAAGTGAAACTGCTGG - Intronic
940105604 2:150096261-150096283 GTTGCCAGGAGTAGAACTGCTGG - Intergenic
940404900 2:153289747-153289769 GTGGGAAGGAGCTAAACTGCAGG + Intergenic
942236728 2:173916751-173916773 GTTGGCAGAAGTGAAATTGCTGG - Intronic
942804087 2:179909400-179909422 ATAGCCAGTAGTGAAATTGCTGG - Intergenic
943048707 2:182890020-182890042 ATGGCCAGAAGTGGAATTGCTGG + Intergenic
943738902 2:191389616-191389638 GTGGCCAGGTGAGCAACTTCTGG - Intronic
944487002 2:200217547-200217569 TGAGCCAGGAGTGAAGCTGCAGG + Intergenic
944630739 2:201621356-201621378 ATGCCCAGGAGTGAAACTGATGG - Exonic
946167338 2:217872667-217872689 ATAGCCAGGAGTGGAACTGCTGG - Intronic
946339236 2:219057625-219057647 GTGGCCCGGTGTGAAGCTGCGGG - Exonic
947267285 2:228297387-228297409 ATGGCCAGGAGTAAAATTGATGG - Intergenic
947424396 2:229970143-229970165 ATGCCCAGGAGTGCAATTGCTGG - Intronic
947655375 2:231822236-231822258 TTGCCCAGGAGTGCAGCTGCTGG + Intergenic
947825463 2:233103291-233103313 ATGCCCAGGAGTGAAGTTGCTGG + Intronic
948224288 2:236296994-236297016 ATGCCCAGGAGTGAAATTGCTGG - Intergenic
948500905 2:238393058-238393080 GTGTCCAGGAGTACAACTGTTGG + Intronic
1168751763 20:287174-287196 ATGCCCAAGAGTAAAACTGCTGG + Intronic
1169182916 20:3586029-3586051 GTACCTAGGAGTAAAACTGCTGG - Intronic
1169228900 20:3873893-3873915 ATACCCAGGAGTGGAACTGCTGG - Exonic
1169297621 20:4413526-4413548 AGGCCCAAGAGTGAAACTGCTGG - Intergenic
1170115829 20:12858486-12858508 ATGTCCAGGAGAGAAATTGCTGG - Intergenic
1170599763 20:17832216-17832238 GCGGAGAGGAGTGAAACGGCTGG - Intergenic
1171354858 20:24536249-24536271 GTGGCCACGGGTGAAATTACCGG + Intronic
1172428320 20:34871357-34871379 GTAGTCAGGAGTGAGACTTCTGG - Intronic
1172519848 20:35559472-35559494 GTGGCCGGTAGTGAAGCTGAAGG - Intergenic
1172740786 20:37165160-37165182 TTACCTAGGAGTGAAACTGCTGG + Intronic
1173261059 20:41436495-41436517 ATGCCCAGGAGTGTAATTGCTGG - Intronic
1174618544 20:51855760-51855782 GTGCCCCGGAGCGCAACTGCTGG + Intergenic
1174899718 20:54485670-54485692 ATGTCCAGGAGTGCAATTGCTGG + Intronic
1175261588 20:57677656-57677678 ATGCCCAGGAGTGCAATTGCTGG - Intronic
1176979905 21:15369559-15369581 ATGGCTAGGAGTGGAATTGCTGG + Intergenic
1177606925 21:23391900-23391922 ATGGCTAGGAGTGCAATTGCTGG - Intergenic
1178306620 21:31496043-31496065 GTGGACAACAGTGATACTGCTGG + Intronic
1178391577 21:32202988-32203010 ATGCCCAGAAGTGGAACTGCTGG + Intergenic
1180055769 21:45358508-45358530 GTGGCCAGTGGTGGAACGGCTGG - Intergenic
1180940060 22:19655020-19655042 ATGCCCAGGAGTGGAATTGCTGG - Intergenic
1180961347 22:19763731-19763753 GTGGCCAGGAGAGATTATGCAGG + Intronic
1181329401 22:22077884-22077906 GTATCCAGCAGTGAAATTGCTGG + Intergenic
1182085607 22:27559116-27559138 GTGCCCAGGAGTGCAATTGCTGG - Intergenic
1183373069 22:37446383-37446405 GTGTCTAGGAGTGGGACTGCAGG + Intergenic
1183657910 22:39200835-39200857 ATGCCCAGGAGTGCAACTGCTGG - Intergenic
1184427343 22:44419134-44419156 GTGCCCAGGAGGGCAATTGCTGG - Intergenic
1184456188 22:44610904-44610926 GTGCCCAGGAATGCAATTGCTGG - Intergenic
1184465406 22:44666369-44666391 GTGCCCAGGAGTGTAATTGCTGG - Intergenic
1184761776 22:46549033-46549055 CTGGCCAGGAGTGACACTGATGG - Intergenic
1184816411 22:46875037-46875059 GTGTGAAGGAGTGGAACTGCTGG - Intronic
1185324761 22:50220210-50220232 GTGGTCAGGAGTGGGACTGTGGG - Intronic
949586397 3:5442695-5442717 ATGTCCAGCAGTGAAATTGCTGG + Intergenic
949935062 3:9110097-9110119 GGGGCCGGGAGAGAAACTGAGGG + Intronic
950124048 3:10500832-10500854 GTAGCAAGGAGAGCAACTGCAGG - Intronic
950386579 3:12664759-12664781 GTGTCTAGAAGTGAAACTGCCGG - Intergenic
950506137 3:13395782-13395804 TTGGGCAGGAGTGGAATTGCCGG + Intronic
952845268 3:37682933-37682955 GTGGCCAGGAGAGGAACAGGGGG - Intronic
952915396 3:38234719-38234741 GTGCCTAGGAGTAGAACTGCTGG - Intronic
953875743 3:46665867-46665889 GTGTCCAGGAGTTAGACTGAGGG - Intergenic
953971266 3:47349315-47349337 GATCCTAGGAGTGAAACTGCTGG + Intergenic
956302143 3:67783610-67783632 GTCTCCAGGAGTGCAACTGCTGG + Intergenic
956371671 3:68570473-68570495 GTGGCCAGGAATGAATCTGGGGG - Intergenic
956680352 3:71773644-71773666 GATGCCAGGAGTCAAAATGCTGG + Intronic
957704426 3:83761171-83761193 GTGCCCAGGAGTGTGATTGCTGG - Intergenic
957821615 3:85383997-85384019 ATTTCCAGGAATGAAACTGCTGG + Intronic
960156580 3:114302477-114302499 GTGCCCAGGAGAGATACAGCTGG - Intronic
960723845 3:120650703-120650725 TTGGCCAGAAGTCAAACTCCAGG - Intronic
961008670 3:123422017-123422039 GTGGCCAGGGGAGAAACACCGGG - Intronic
961453485 3:127013131-127013153 GTGGCCAGGAGTGATCCTCATGG - Intronic
962722803 3:138192005-138192027 ATGCCCAGGAGTGCAATTGCAGG + Intronic
963089243 3:141466829-141466851 TCAGCCAGGAGTGAAATTGCTGG - Intergenic
963227303 3:142875447-142875469 GTAGTCAGGAGTGGAACTGCTGG - Intronic
963385534 3:144588099-144588121 GTGCCCAGGAATGCAATTGCTGG + Intergenic
964075250 3:152684812-152684834 GAGGCCAGGAGTGATGCTGAGGG - Intergenic
966427307 3:179793028-179793050 GAGACCAGGAGTGCAGCTGCTGG + Intergenic
966659817 3:182401786-182401808 GTATACAGGAGTGAAATTGCTGG - Intergenic
966701378 3:182856011-182856033 ATGCCCAAGAGTGCAACTGCTGG - Intronic
966835710 3:184048088-184048110 GTGACCAGGTGTGAAGCTGGAGG + Intergenic
967164806 3:186771179-186771201 ATGCCCAAGAGTGAAATTGCTGG + Intergenic
967374588 3:188786557-188786579 ATGCCCAGGAGTGCAACTGCTGG - Intronic
967393835 3:188984110-188984132 ATGGCCAGGAGTGCAATTACTGG + Intronic
967594318 3:191312413-191312435 GTGGACAGGACTGATTCTGCTGG + Intronic
968290392 3:197534588-197534610 GTGCCCAGGGGTGTAATTGCTGG + Intronic
969154591 4:5199302-5199324 GTAGCCAGGAGTGGTACTGCAGG + Intronic
969641518 4:8401799-8401821 GAGGCCAGGAGAGAACCTGGTGG - Intronic
969760274 4:9176154-9176176 CTGACCTGGAGTGAGACTGCAGG + Exonic
971903055 4:32687676-32687698 ATGCCCAGAAGTGAAATTGCTGG - Intergenic
972452218 4:39213215-39213237 ATGGCCAGATGTGTAACTGCTGG - Intronic
976449874 4:85176168-85176190 ATGCCCAGGAGTGCAATTGCTGG + Intergenic
978614712 4:110582908-110582930 ATGGCTAGGAGTGCAATTGCTGG - Intergenic
978828854 4:113058113-113058135 GTGGCCAGAAGTGAAATGGTTGG - Intronic
981855876 4:149291611-149291633 GTGTCCAGGAATGCAATTGCTGG - Intergenic
981939763 4:150270194-150270216 ATGCCCAGGAGTGGAATTGCTGG - Intronic
983564905 4:169139652-169139674 ATGTCCAGGAGTAGAACTGCTGG + Intronic
984287414 4:177749911-177749933 ATGCCCAGGAGTGAGATTGCTGG + Intronic
984951580 4:185011664-185011686 ATGGGCAGGAGTCAAGCTGCAGG - Intergenic
985483700 5:136837-136859 GTGCCCAGAAGTGGAACTGCTGG - Intergenic
985531960 5:438989-439011 GGGGTGAGGAGTGAAAATGCGGG - Intergenic
986731575 5:10638417-10638439 GTGGGCAGGAGGAAAACAGCAGG - Intronic
987057460 5:14208136-14208158 ATACACAGGAGTGAAACTGCTGG - Intronic
987562586 5:19542396-19542418 ATGCCTAGGAGTGAAATTGCTGG - Intronic
987588799 5:19895491-19895513 ATACCCAGGAGTGAAATTGCTGG - Intronic
987752238 5:22055406-22055428 GTTGTCAGGAATGAAAATGCAGG - Intronic
989573091 5:42963478-42963500 ATGTCCAGAAGTGAAATTGCTGG - Intergenic
989732623 5:44665616-44665638 GTGGCCGGCAGTGCATCTGCTGG - Intergenic
990365395 5:55065469-55065491 GTTCCTAGGAGTGAAATTGCTGG + Intergenic
991169610 5:63605884-63605906 ATAGCCAGCAGTGAGACTGCTGG - Intergenic
991419394 5:66426036-66426058 GTGGTAGGGAGGGAAACTGCTGG + Intergenic
992745685 5:79818251-79818273 GTATCCAGGAGTGGAATTGCTGG - Intergenic
993489556 5:88530009-88530031 ATGCCCAGGAGTGTAATTGCTGG + Intergenic
993708893 5:91203160-91203182 CTGCCTAGGAGTGAAATTGCTGG - Intergenic
993787033 5:92154185-92154207 GGGCCGAGGAGTGAAATTGCTGG + Intergenic
994630629 5:102281885-102281907 ATGCCCAGGAGTAAAACTGCTGG - Intronic
994995334 5:107054994-107055016 ATAGCTAGGAGTGAAATTGCTGG - Intergenic
997144036 5:131412828-131412850 GTACCCAGAAGTGGAACTGCTGG + Intergenic
998168572 5:139858774-139858796 GTGCACAGGCGTGAATCTGCAGG - Intronic
998447380 5:142208841-142208863 ATGCCCAGGAGTGCAATTGCTGG + Intergenic
998795673 5:145815909-145815931 GTATCTAGGAGTGAAATTGCTGG + Intronic
999678817 5:154035698-154035720 ATGACCAAGAGTGCAACTGCTGG + Intronic
1000068222 5:157715362-157715384 GTACCCAGAAGTGAAATTGCAGG + Intergenic
1000941920 5:167372041-167372063 TTGGCAAGGAGTGAACCTGTTGG + Intronic
1001631420 5:173178200-173178222 GTACCCAGGAGTGGAATTGCTGG - Intergenic
1001739597 5:174041189-174041211 GAGGCCAGGAGAGAAGCTGCAGG - Intergenic
1002399733 5:178984897-178984919 GTGACCTGGTGTGACACTGCAGG - Intronic
1002762441 6:212334-212356 ATGCCCAGAAGTGGAACTGCTGG - Intergenic
1003888515 6:10542856-10542878 GATACCAAGAGTGAAACTGCTGG + Intronic
1004359627 6:14959682-14959704 ATACCCAGGAGTGAAATTGCTGG - Intergenic
1004401692 6:15294566-15294588 GTGAGGAGGAGTGAAAGTGCAGG + Intronic
1004431120 6:15544419-15544441 ATGCCCAAGAGTGCAACTGCTGG + Intronic
1005378092 6:25205578-25205600 ATGCCTAGGAGTGAAATTGCCGG - Intergenic
1005535402 6:26750097-26750119 GAAGCCAGGAGTGAAGCTTCTGG + Intergenic
1005762358 6:28978935-28978957 ATGTCCAGGAGTGCAGCTGCCGG - Intergenic
1006247581 6:32752970-32752992 GTACCCAGAAGTGGAACTGCTGG - Intergenic
1006546945 6:34788130-34788152 GTGCCCAGGAGTGCAATAGCTGG - Intergenic
1006675989 6:35764038-35764060 ATGCTCAGCAGTGAAACTGCTGG - Intergenic
1006989651 6:38203379-38203401 ATAGCCAGAAGTGAAATTGCTGG - Intronic
1007163797 6:39813713-39813735 GTGGCCAGGTGGGAAGCTGTGGG - Intronic
1008410319 6:51171034-51171056 ATGCCCAGTAGTGAAACTGCTGG - Intergenic
1009006436 6:57793730-57793752 GAAGCCAGGAGTGAAGCTTCTGG + Intergenic
1009846605 6:69142914-69142936 ATGCCCAGGAGTGGAATTGCTGG + Intronic
1010265416 6:73860299-73860321 GTAGCTAGGAGTGAAATTGCTGG + Intergenic
1011435921 6:87336541-87336563 CTGGCCAGGAGTGAATCTGTAGG + Intronic
1011495846 6:87936089-87936111 GTGGGGAGGAGAGAAACTGGGGG + Intergenic
1013547119 6:111169234-111169256 TTGGACAGGAGTCAAACTCCAGG - Intronic
1015031149 6:128597505-128597527 GTAACCAGGAGTGAAACAGTGGG - Intergenic
1015101303 6:129484405-129484427 GTACCCAGGAGTGGAATTGCTGG - Intronic
1016636102 6:146292746-146292768 GTATCCAGGAATGAAAATGCTGG - Intronic
1016984159 6:149881876-149881898 ATGCCCAGTAGTGAAATTGCTGG - Intergenic
1017351981 6:153453274-153453296 ATAGCCAGTAGTGAAATTGCTGG + Intergenic
1017823557 6:158065380-158065402 GGGGCCAAGAGAGAAACTGGAGG - Intronic
1018064802 6:160117415-160117437 GTGGTCAGGAGGGTAGCTGCAGG + Intergenic
1018255306 6:161912513-161912535 GTGTCCAGGAGTGCAAATGCAGG - Intronic
1019753895 7:2753696-2753718 ATGCCCAGGAGTGTGACTGCCGG + Intronic
1020273118 7:6608455-6608477 GTGGCGAGGAGTGTGACGGCAGG + Exonic
1020458748 7:8404174-8404196 GTGCCCAGAAGTGGAATTGCTGG - Intergenic
1023636747 7:42219798-42219820 GTGGATAGGAGAGAAAATGCAGG + Intronic
1023787973 7:43727348-43727370 GTGCCTAGGAGTGAAATGGCTGG - Intronic
1024027128 7:45421191-45421213 TTGCCCAGGAGTGCAACTGTTGG + Intergenic
1026557442 7:71420723-71420745 CAGCCCAGGAGTGAAGCTGCAGG + Intronic
1026791887 7:73338492-73338514 GTGCCTAGGAGTGCAATTGCTGG + Intronic
1027266846 7:76499201-76499223 GTGACCTGGAGGGAAACTGCTGG - Intronic
1027318663 7:76999061-76999083 GTGACCTGGAGGGAAACTGCTGG - Intergenic
1029194290 7:98793931-98793953 AAGGCCAGAAGTGCAACTGCTGG - Intergenic
1029394239 7:100296302-100296324 GTCACCAGGAGTGGAGCTGCTGG - Intergenic
1029943873 7:104511446-104511468 ATGTCCAGGAGTGCAAGTGCTGG - Intronic
1031633211 7:124069220-124069242 GAGGCCAGGATTGAAAGTGATGG + Intergenic
1032272733 7:130425631-130425653 GTGCTCAGGAGTACAACTGCTGG - Intronic
1032643134 7:133792086-133792108 GATGCCACGAGTAAAACTGCTGG - Intronic
1033424814 7:141234470-141234492 GTGGCTAGGAGGGAGAATGCAGG + Intronic
1033549060 7:142429143-142429165 ATACCCAGGAGTGAAACTTCTGG + Intergenic
1033792295 7:144805266-144805288 ATGCCCAGGAGTGCAATTGCTGG - Intronic
1034462728 7:151206877-151206899 GTGGGCAGGAGTGAGACTTTGGG + Intergenic
1034488397 7:151380506-151380528 GGTGCCAGGAGAGAAGCTGCAGG - Intronic
1035022204 7:155806488-155806510 GTGGCCAGGAGTGAAACTGCGGG - Exonic
1035563245 8:624394-624416 GTGCCTAGGAGTAGAACTGCAGG - Intronic
1035581880 8:745564-745586 GTTTCCAGAAGTGAAATTGCTGG - Intergenic
1035656150 8:1307499-1307521 ATGGCCAGAAGTGAAATTTCTGG - Intergenic
1035684575 8:1513785-1513807 GTGACCATGGGTGAAACTGGGGG - Intronic
1035917977 8:3645523-3645545 GTGGTCAGAGGTGAAGCTGCAGG + Intronic
1035930930 8:3778673-3778695 TTGGCCAGCTCTGAAACTGCAGG - Intronic
1035948387 8:3991083-3991105 GTGGCCAGGGATGAAGCCGCTGG - Intronic
1036263897 8:7259901-7259923 CTGACCTGGAGTGAGACTGCAGG + Intergenic
1036265193 8:7267523-7267545 CTGACCTGGAGTGAGACTGCAGG + Intergenic
1036266494 8:7275145-7275167 CTGACCTGGAGTGAGACTGCAGG + Intergenic
1036267800 8:7282767-7282789 CTGACCTGGAGTGAGACTGCAGG + Intergenic
1036269103 8:7290389-7290411 CTGACCTGGAGTGAGACTGCAGG + Intergenic
1036270397 8:7298011-7298033 CTGACCTGGAGTGAGACTGCAGG + Intergenic
1036297488 8:7549044-7549066 CTGACCTGGAGTGAGACTGCAGG - Intergenic
1036298792 8:7556691-7556713 CTGACCTGGAGTGAGACTGCAGG - Intergenic
1036300097 8:7564341-7564363 CTGACCTGGAGTGAGACTGCAGG - Intergenic
1036301401 8:7571986-7572008 CTGACCTGGAGTGAGACTGCAGG - Intergenic
1036302698 8:7579635-7579657 CTGACCTGGAGTGAGACTGCAGG - Intergenic
1036315937 8:7718440-7718462 CTGACCTGGAGTGAGACTGCAGG + Intergenic
1036317244 8:7726088-7726110 CTGACCTGGAGTGAGACTGCAGG + Intergenic
1036318552 8:7733736-7733758 CTGACCTGGAGTGAGACTGCAGG + Intergenic
1036319861 8:7741383-7741405 CTGACCTGGAGTGAGACTGCAGG + Intergenic
1036321168 8:7749031-7749053 CTGACCTGGAGTGAGACTGCAGG + Intergenic
1036322477 8:7756679-7756701 CTGACCTGGAGTGAGACTGCAGG + Intergenic
1036323785 8:7764327-7764349 CTGACCTGGAGTGAGACTGCAGG + Intergenic
1036325087 8:7771975-7771997 CTGACCTGGAGTGAGACTGCAGG + Intergenic
1036350957 8:8012333-8012355 CTGACCTGGAGTGAGACTGCAGG - Intergenic
1036352255 8:8019979-8020001 CTGACCTGGAGTGAGACTGCAGG - Intergenic
1036353554 8:8027627-8027649 CTGACCTGGAGTGAGACTGCAGG - Intergenic
1036580563 8:10071010-10071032 GTGCCCAGGAGTGCAATTGCTGG + Intronic
1037180188 8:15995657-15995679 ATTCCCAGGAGTGAAATTGCTGG + Intergenic
1037891506 8:22626306-22626328 GTGGGCTGGGGTGAGACTGCTGG + Intronic
1038086341 8:24201354-24201376 ATAGCTAGGAGTGAAACTGCTGG + Intergenic
1038193976 8:25349399-25349421 ATGCCCAGGAGTGGAATTGCTGG - Intronic
1040787157 8:51179198-51179220 ATGCCCAGGAGTGCAATTGCTGG - Intergenic
1041225567 8:55694106-55694128 CTGTCTGGGAGTGAAACTGCTGG + Intergenic
1041346277 8:56901929-56901951 GTGGACTGGAGTGAGGCTGCAGG - Intergenic
1041449856 8:57994823-57994845 GGGGCCGGGAGAGAGACTGCTGG + Intronic
1041557922 8:59179858-59179880 ATGGCCAGGAGTGAAATTGCTGG + Intergenic
1043573411 8:81630483-81630505 GTGACCAGGACAGAAACAGCAGG - Intergenic
1043578445 8:81685800-81685822 GTGACCAGGACAGAAACAGCAGG - Exonic
1044440106 8:92213790-92213812 ATGTCTAGGAGTGTAACTGCCGG + Intergenic
1044787795 8:95813915-95813937 ATAGCCAGTAGTGAGACTGCTGG + Intergenic
1045656845 8:104395800-104395822 ATACCCAGGAGTGAAATTGCTGG + Intronic
1045878375 8:107009557-107009579 GTACCCAGGAGTGGAATTGCTGG - Intergenic
1047609223 8:126504705-126504727 CCTGCAAGGAGTGAAACTGCAGG + Intergenic
1048006088 8:130420399-130420421 ATGGCCAGGAGTGGAGGTGCTGG - Intronic
1048810624 8:138282811-138282833 ATGCCAAGGAGTGCAACTGCTGG - Intronic
1049305802 8:141903201-141903223 GTAGGCAGGAGACAAACTGCTGG + Intergenic
1050050104 9:1590747-1590769 ATGCCTAGGAGTGAAATTGCCGG - Intergenic
1051317178 9:15852095-15852117 GTAGCTAGGAGTGGAACTGCTGG + Intronic
1051448980 9:17174350-17174372 ATGGCCAGGAGTGTAATTGCTGG + Intronic
1051474070 9:17483441-17483463 ATGGCTAGAATTGAAACTGCTGG - Intronic
1051657253 9:19394941-19394963 ATGTCCAGGTGTGAAATTGCTGG - Intergenic
1051887430 9:21908467-21908489 ATGCCCAGAAGTGAAATTGCTGG + Intronic
1052259540 9:26497696-26497718 GAGGCCAGGGGGGAAACTGGAGG + Intergenic
1053235813 9:36453010-36453032 GTATCTAGGAGTGGAACTGCTGG + Intronic
1053512931 9:38704843-38704865 GTGGCCATCACTGAAAATGCAGG + Intergenic
1053585633 9:39455648-39455670 ATTCCTAGGAGTGAAACTGCTGG - Intergenic
1053783225 9:41631824-41631846 GTGGTAAGGGGTGAAACTGTGGG + Intergenic
1054171178 9:61841966-61841988 GTGGTAAGGGGTGAAACTGTGGG + Intergenic
1054580678 9:66909577-66909599 ATTCCTAGGAGTGAAACTGCTGG + Intronic
1054666355 9:67738846-67738868 GTGGTAAGGGGTGAAACTGTGGG - Intergenic
1054868489 9:70026841-70026863 GTATCTAGAAGTGAAACTGCTGG + Intergenic
1055529851 9:77173196-77173218 ATGTCCAGGAGTGCAATTGCTGG + Intergenic
1055556004 9:77474626-77474648 ATGCCTAGGAGTGGAACTGCTGG - Intronic
1056028555 9:82526353-82526375 GTGGTCAGGAGAGAAAGTGGAGG - Intergenic
1056446802 9:86674304-86674326 GTGCCCAGGAGTGAAACGCAAGG - Intergenic
1057251259 9:93504771-93504793 GTGCCCAGGAGTGGAATTCCAGG + Intronic
1057310185 9:93938068-93938090 GTGCCCAGGGGTGGAACTGCTGG - Intergenic
1057468959 9:95340797-95340819 ATACCTAGGAGTGAAACTGCTGG - Intergenic
1057710244 9:97434652-97434674 ATGTCCAGGAGCGCAACTGCTGG - Intronic
1057842565 9:98497861-98497883 GTGCCCAGAAGTGGAATTGCTGG - Intronic
1059081922 9:111259153-111259175 ATGCCTAGGAGTGGAACTGCTGG - Intergenic
1059342536 9:113606344-113606366 ATGACCAGGAGTGCAATTGCTGG + Intergenic
1059695471 9:116726160-116726182 GTGACCAAGAGGGAATCTGCAGG + Intronic
1060297993 9:122355944-122355966 GTGGCCAAGGGTGCAACGGCTGG + Intergenic
1060308403 9:122437067-122437089 ATTTCTAGGAGTGAAACTGCTGG + Intergenic
1061025482 9:128046054-128046076 ATGCCCAGGAGTGAAATAGCTGG - Intergenic
1061039818 9:128133912-128133934 TCATCCAGGAGTGAAACTGCTGG + Intergenic
1062623176 9:137431659-137431681 GTGACCAGGAGTGACCCAGCTGG + Intronic
1062673676 9:137726632-137726654 GTGCCCAGCAGTGGAACTGCTGG + Intronic
1062675133 9:137738521-137738543 GTGCCCAGCAGTGGAACTGCTGG - Intronic
1186560582 X:10608234-10608256 ATGCCCAGGAGTGCAATTGCTGG - Intronic
1186626273 X:11297004-11297026 GTGGCCAGGCGGGAGGCTGCTGG - Intronic
1187091247 X:16099170-16099192 GTTCCCAGGAGTGAAAGTTCAGG - Intergenic
1187186306 X:16989914-16989936 ATGCCCAGGAGTGCAATTGCTGG - Intronic
1187445121 X:19354404-19354426 CTGGCCAGGAGTGAAAATGCAGG + Intronic
1187545640 X:20249324-20249346 ATGTCCAGGAGTACAACTGCTGG + Intronic
1187925461 X:24245640-24245662 GTACCCAGGAGTAAAACTGATGG + Intergenic
1188840214 X:35008000-35008022 ATGCCTAGGAGTGAAATTGCTGG - Intergenic
1189561352 X:42194446-42194468 GTGGCCATGAGAGAAGCTACTGG - Intergenic
1189742163 X:44130476-44130498 GTACCCAGGAGTGAAATTGCTGG + Intergenic
1191136509 X:57070297-57070319 GGGGCCAGGCGTGAAAATTCGGG - Intergenic
1192123680 X:68480650-68480672 GTATCTAGGAGTGAAATTGCTGG - Intergenic
1195452177 X:105027808-105027830 GTGCCCAGCAGTGAGATTGCTGG - Intronic
1195652014 X:107294771-107294793 ATGCCCAGGAGTGCAATTGCTGG + Intergenic
1195668148 X:107449122-107449144 GTGACCAGGAGGGGAGCTGCAGG + Intergenic
1195901549 X:109802998-109803020 CTGCCCAGGAGTAAAATTGCTGG - Intergenic
1195946508 X:110219152-110219174 ATAGCTAGGAGTGGAACTGCTGG + Intronic
1196000362 X:110777358-110777380 ATATCAAGGAGTGAAACTGCTGG + Intronic
1196134747 X:112196496-112196518 ATGCCCAGGAGTGCAATTGCTGG + Intergenic
1196323329 X:114370606-114370628 GTGTCTAAGAGTGAAATTGCTGG - Intergenic
1196353137 X:114756327-114756349 AAGCCCAGGAGTGCAACTGCTGG - Intronic
1198014809 X:132599401-132599423 ATAGCTAGGAGTGAAATTGCTGG - Intergenic
1198278808 X:135122210-135122232 GTGGCCAGGAGAAAACCTGCGGG - Intergenic
1198292152 X:135250306-135250328 GTGGCCAGGAGAAAACCTGCGGG + Intronic
1198324882 X:135559650-135559672 ATGCCCAGGAGTGCAATTGCTGG + Intronic
1198630695 X:138634873-138634895 CTAGCCAGGAGTGAGATTGCTGG - Intronic
1199247001 X:145617164-145617186 ATGCCCAGGAGTGCAATTGCTGG - Intergenic
1199332865 X:146582335-146582357 GCAGCCAGGAGTGAGAGTGCAGG - Intergenic
1199558371 X:149134582-149134604 GTCCCCAGGAGTGGAATTGCTGG + Intergenic
1199688666 X:150289230-150289252 ATGGCCAGGAGAGAAATTGCTGG - Intergenic
1201304753 Y:12541251-12541273 GTGGTCAGGAGTGCTACTGCTGG - Intergenic