ID: 1035022751

View in Genome Browser
Species Human (GRCh38)
Location 7:155808872-155808894
Sequence GCTTCCCCCAGCGCGGGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035022743_1035022751 -6 Left 1035022743 7:155808855-155808877 CCGCCAGCAGCCGGTGGGCTTCC 0: 1
1: 0
2: 1
3: 26
4: 208
Right 1035022751 7:155808872-155808894 GCTTCCCCCAGCGCGGGGGCGGG No data
1035022734_1035022751 29 Left 1035022734 7:155808820-155808842 CCTCCCTGATCTGCGAGCCGCGC 0: 1
1: 0
2: 0
3: 2
4: 60
Right 1035022751 7:155808872-155808894 GCTTCCCCCAGCGCGGGGGCGGG No data
1035022744_1035022751 -9 Left 1035022744 7:155808858-155808880 CCAGCAGCCGGTGGGCTTCCCCC 0: 1
1: 0
2: 1
3: 12
4: 178
Right 1035022751 7:155808872-155808894 GCTTCCCCCAGCGCGGGGGCGGG No data
1035022735_1035022751 26 Left 1035022735 7:155808823-155808845 CCCTGATCTGCGAGCCGCGCCGG 0: 1
1: 0
2: 0
3: 0
4: 34
Right 1035022751 7:155808872-155808894 GCTTCCCCCAGCGCGGGGGCGGG No data
1035022739_1035022751 7 Left 1035022739 7:155808842-155808864 CCGGCGAGTGTCACCGCCAGCAG 0: 1
1: 0
2: 0
3: 3
4: 77
Right 1035022751 7:155808872-155808894 GCTTCCCCCAGCGCGGGGGCGGG No data
1035022738_1035022751 12 Left 1035022738 7:155808837-155808859 CCGCGCCGGCGAGTGTCACCGCC 0: 1
1: 0
2: 0
3: 4
4: 62
Right 1035022751 7:155808872-155808894 GCTTCCCCCAGCGCGGGGGCGGG No data
1035022737_1035022751 25 Left 1035022737 7:155808824-155808846 CCTGATCTGCGAGCCGCGCCGGC 0: 1
1: 0
2: 0
3: 6
4: 60
Right 1035022751 7:155808872-155808894 GCTTCCCCCAGCGCGGGGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035022751 Original CRISPR GCTTCCCCCAGCGCGGGGGC GGG Intronic
No off target data available for this crispr