ID: 1035024801

View in Genome Browser
Species Human (GRCh38)
Location 7:155818533-155818555
Sequence TGTATACACGGCAAGAACTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035024801_1035024815 30 Left 1035024801 7:155818533-155818555 CCCCAGTTCTTGCCGTGTATACA No data
Right 1035024815 7:155818586-155818608 CCCCTTCCTGTGGCATCCACTGG No data
1035024801_1035024810 20 Left 1035024801 7:155818533-155818555 CCCCAGTTCTTGCCGTGTATACA No data
Right 1035024810 7:155818576-155818598 CCCCTCCTTGCCCCTTCCTGTGG 0: 2
1: 0
2: 5
3: 62
4: 533

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035024801 Original CRISPR TGTATACACGGCAAGAACTG GGG (reversed) Intergenic
No off target data available for this crispr