ID: 1035024805

View in Genome Browser
Species Human (GRCh38)
Location 7:155818545-155818567
Sequence TGGGTTCTGCCTTGTATACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035024805_1035024819 25 Left 1035024805 7:155818545-155818567 CCGTGTATACAAGGCAGAACCCA No data
Right 1035024819 7:155818593-155818615 CTGTGGCATCCACTGGATCGTGG No data
1035024805_1035024810 8 Left 1035024805 7:155818545-155818567 CCGTGTATACAAGGCAGAACCCA No data
Right 1035024810 7:155818576-155818598 CCCCTCCTTGCCCCTTCCTGTGG 0: 2
1: 0
2: 5
3: 62
4: 533
1035024805_1035024815 18 Left 1035024805 7:155818545-155818567 CCGTGTATACAAGGCAGAACCCA No data
Right 1035024815 7:155818586-155818608 CCCCTTCCTGTGGCATCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035024805 Original CRISPR TGGGTTCTGCCTTGTATACA CGG (reversed) Intergenic
No off target data available for this crispr