ID: 1035024807

View in Genome Browser
Species Human (GRCh38)
Location 7:155818565-155818587
Sequence GGCAAGGAGGGGGTCACTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035024807_1035024821 20 Left 1035024807 7:155818565-155818587 CCAAGAGTGACCCCCTCCTTGCC No data
Right 1035024821 7:155818608-155818630 GATCGTGGCCCCGCCCACACTGG No data
1035024807_1035024815 -2 Left 1035024807 7:155818565-155818587 CCAAGAGTGACCCCCTCCTTGCC No data
Right 1035024815 7:155818586-155818608 CCCCTTCCTGTGGCATCCACTGG No data
1035024807_1035024822 23 Left 1035024807 7:155818565-155818587 CCAAGAGTGACCCCCTCCTTGCC No data
Right 1035024822 7:155818611-155818633 CGTGGCCCCGCCCACACTGGAGG No data
1035024807_1035024819 5 Left 1035024807 7:155818565-155818587 CCAAGAGTGACCCCCTCCTTGCC No data
Right 1035024819 7:155818593-155818615 CTGTGGCATCCACTGGATCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035024807 Original CRISPR GGCAAGGAGGGGGTCACTCT TGG (reversed) Intergenic
No off target data available for this crispr