ID: 1035024808

View in Genome Browser
Species Human (GRCh38)
Location 7:155818575-155818597
Sequence CACAGGAAGGGGCAAGGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035024808_1035024819 -5 Left 1035024808 7:155818575-155818597 CCCCCTCCTTGCCCCTTCCTGTG No data
Right 1035024819 7:155818593-155818615 CTGTGGCATCCACTGGATCGTGG No data
1035024808_1035024822 13 Left 1035024808 7:155818575-155818597 CCCCCTCCTTGCCCCTTCCTGTG No data
Right 1035024822 7:155818611-155818633 CGTGGCCCCGCCCACACTGGAGG No data
1035024808_1035024821 10 Left 1035024808 7:155818575-155818597 CCCCCTCCTTGCCCCTTCCTGTG No data
Right 1035024821 7:155818608-155818630 GATCGTGGCCCCGCCCACACTGG No data
1035024808_1035024826 22 Left 1035024808 7:155818575-155818597 CCCCCTCCTTGCCCCTTCCTGTG No data
Right 1035024826 7:155818620-155818642 GCCCACACTGGAGGTCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035024808 Original CRISPR CACAGGAAGGGGCAAGGAGG GGG (reversed) Intergenic
No off target data available for this crispr