ID: 1035024813

View in Genome Browser
Species Human (GRCh38)
Location 7:155818581-155818603
Sequence GGATGCCACAGGAAGGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035024813_1035024821 4 Left 1035024813 7:155818581-155818603 CCTTGCCCCTTCCTGTGGCATCC No data
Right 1035024821 7:155818608-155818630 GATCGTGGCCCCGCCCACACTGG No data
1035024813_1035024822 7 Left 1035024813 7:155818581-155818603 CCTTGCCCCTTCCTGTGGCATCC No data
Right 1035024822 7:155818611-155818633 CGTGGCCCCGCCCACACTGGAGG No data
1035024813_1035024826 16 Left 1035024813 7:155818581-155818603 CCTTGCCCCTTCCTGTGGCATCC No data
Right 1035024826 7:155818620-155818642 GCCCACACTGGAGGTCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035024813 Original CRISPR GGATGCCACAGGAAGGGGCA AGG (reversed) Intergenic
No off target data available for this crispr